Previous Contig 002136:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF032J01Sequence548002136 (6)709010959 (3)gb:AP000570_18203601e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0711E10
JMFF050B13Sequence631002136 (6)640010959 (3)gb:AP000570_18203601e-09Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0711E10
JMFS106F06Sequence618002136 (6)
JMSF026D20Sequence597002136 (6)805002136 (6)gb:AB024033_15157911e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.
JMSF034A15Sequence684002136 (6)gb:AB024033_15157913e-24Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.708010959 (3)pir|H84508|H845089e-45hypothetical protein At2g13600 [imported] - Arabidopsis thaliana>gb:AC007063_153

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF034A15+ C
                      ____________________________________________________________
consensus C
 
. : . : . : . : . : . :
JMSF034A15+ ATTGACAAGAATATTGACAGAGCTTTCTCAGATTGACCCGACTTGGCATATCCCGAAATC
                      ____________________________________________________________
consensus ATTGACAAGAATATTGACAGAGCTTTCTCAGATTGACCCGACTTGGCATATCCCGAAATC
 
. : . : . : . : . : . :
JMSF034A15+ AAACAAGTCCAGCAAGAAATCACATCCTTTTGAGGCATTTCATCAAACAATTTACAAGCA
                      ____________________________________________________________
consensus AAACAAGTCCAGCAAGAAATCACATCCTTTTGAGGCATTTCATCAAACAATTTACAAGCA
 
. : . : . : . : . : . :
JMSF034A15+ GAGTCGAAATCTTTCAGGCTCTTAGCGTACACGCTCAACAAGCCATTACAGACAAAAGAA
rJMSF026D20- TCTTAGCGTACACGCTCAACAAACCATTACATACAAAAGAA
                      ____________________________________________________________
consensus GAGTCGAAATCTTTCAGGCTCTTAGCGTACACGCTCAACAAGCCATTACATACAAAAGAA
 
. : . : . : . : . : . :
JMSF034A15+ TTAACTAAAAATCCAAACTTTACAACGTGGGCATGAACCTGCTGAACATAACTTGAATCA
rJMSF026D20- TTAACTAAAAACCCAAACTTTACAATGTGGGCATGAACCTGCTGAACATAAGTTGAATCA
                      ____________________________________________________________
consensus TTAACTAAAAATCCAAACTTTACAATGTGGGCATGAACCTGCTGAACATAAGTTGAATCA
 
. : . : . : . : . : . :
JMSF034A15+ CTGGCGCGGGCACAAGCTTTAAGGAGAAAAGAAAACGTCAAGTCATTGGGAGAGAGGAAC
rJMSF026D20- CTGGTGCAGGTACAAGCTTTAAGGAGAAAAGAAAACGTCAAGTCATTGGGAGAGAGGAAC
                      ____________________________________________________________
consensus CTGGTGCGGGTACAAGCTTTAAGGAGAAAAGAAAACGTCAAGTCATTGGGAGAGAGGAAC
 
. : . : . : . : . : . :
JMSF034A15+ TTTAACTTAATCAAATTTTTATACACCAAAAACGCATCAGAATATAAACCCTCTTCAGAC
rJMSF026D20- TTTAACTTTTTCAATTTTTTATACACCAAAAACGCATCAAAATATAAACCCTCTTCAGAC
                      ____________________________________________________________
consensus TTTAACTTTTTCAATTTTTTATACACCAAAAACGCATCAGAATATAAACCCTCTTCAGAC
 
. : . : . : . : . : . :
JMSF034A15+ AACACTCGGATAATGGCGTTGAAAGGGAAAAGATTGGGCTTCTGCAGGTGATGGAAAACG
rJMSF026D20- AACACTCGGACAATGGCGTTGAAAGGGAAAAGATTGGTCTTCTGCAGGTGATGGAAAACG
                      ____________________________________________________________
consensus AACACTCGGATAATGGCGTTGAAAGGGAAAAGATTGGTCTTCTGCAGGTGATGGAAAACG
 
. : . : . : . : . : . :
JMSF034A15+ TGGAGAGCTAGCTTGGACGGGTACTGGCCGACAAGGCGAGTAGCTACGAGGTTGTCTTGG
rJMSF026D20- CGGAGAGCTAGCTTCGACGGGTACTGGCCGACAAGGCGAGTAGCTACGAGGTTGTCTTGG
                      ____________________________________________________________
consensus TGGAGAGCTAGCTTGGACGGGTACTGGCCGACAAGGCGAGTAGCTACGAGGTTGTCTTGG
 
. : . : . : . : . : . :
JMSF034A15+ TGTGCGCCAAGACGAAAAACGCGAGCGTGGATTTGGACGAGATGAGAGGTGGGAATACGA
rJMSF026D20- TGTGCGCCAATACGAAAAACACGAGCGTGGATTTGGAAGAGATGAGAACTGGGAATCCGG
JMFS106F06+ GGATTTGGAAGAGATGAGAACTGGGAATCCGG
JMFF050B13+ GGATTTGGAAGAGATGAGAACTGGGAATCCGG
                      ____________________________________________________________
consensus TGTGCGCCAATACGAAAAACGCGAGCGTGGATTTGGAAGAGATGAGAACTGGGAATCCGG
 
. : . : . : . : . : . :
JMSF034A15+ CCTTGTAAAAGCTGGGAGAGAGGGGCGAAATCTGAATTGGGTGAAAGCGAGTGCATGAAA
rJMSF026D20- CCTTGTAAGAGCTGGGAGAGACGGGCGAAATCTGAATTGGGTGAAAGCGAGTGCATGAAA
JMFS106F06+ CCTTGTAAGAGCTGGGAGAGACGGGCGAAATCTGAATTGGGTGAAAGCGAGTGCATGAAA
JMSF026D20+ CTTGTAAGAGCTGGGAGAGACGGGCGAAATCTGAATTGGGTGAAAGCGAGTGCATGAAA
JMFF032J01+ GAAAGCGAGTGCATGAAA
JMFF050B13+ -CCTGTAAGAGCTGGGAGAGACGGGCGAAATCTGAATTGGGTGAAAGCGAGTGCATGAAA
                      ____________________________________________________________
consensus CCTTGTAAGAGCTGGGAGAGACGGGCGAAATCTGAATTGGGTGAAAGCGAGTGCATGAAA
 
. : . : . : . : . : . :
JMSF034A15+ TGATAGAGAAATGGCAAGAGAGAAGAAACATGCACTCTCCAGTTGGGGAAATGAGAATGC
rJMSF026D20- TGATAGAGAAATGGCCAGATAGAAGAAACATGCGCTCTCGAGTTGGGGAAATGAGAACGC
JMFS106F06+ TGATAGAGAAATGGCCAGATAGAAGAAACATGCGCTCTCGAGTTGGGGAAATGAGAACGC
JMSF026D20+ TGATAGAGAAATGGCCAGATAGAAGAAACATGCGCTCTCGAGTTGGGGAAATGAGAACGC
JMFF032J01+ TGATAGAGAAATGGCCAGATAGAAGAAACATGCGCTCTCGAGTTGGGGAAATGAGAACGC
JMFF050B13+ TGATAGAGAAATGGCCAGATAGAAGAAACATGCGCTCTCGAGTTGGGGAAATGAGAACGC
                      ____________________________________________________________
consensus TGATAGAGAAATGGCCAGATAGAAGAAACATGCGCTCTCGAGTTGGGGAAATGAGAACGC
 
. : . : . : . : . : . :
JMSF034A15+ TGGGAAATGTGCATCATCCTTT
rJMSF026D20- TGGAAAATGTGCATCATCCTTTGTGTTTGTGGCTTCAACAACTTCGCTGCTTCGCATCAT
JMFS106F06+ TGGAAAATGTGCATAATCCTTTGTGTTTGTGGCTTCAACAACTTCGCTGCTTCGCATCAT
JMSF026D20+ TGGAAAATGTGCATCATCCTTTGTGTTTGTGGCTTCAACAACTTCGCTGCTTCGCATCAT
JMFF032J01+ TGGAAAATGTGCATCATCCTTTGTGTTTGTGGCTTCAACAACTTCGCTGCTTCGCATCAT
JMFF050B13+ TGGAAAATGTGCATCATCCTTTGTGTTTGTGGCTTCAACAACTTCGCTGCTTCGCATCAT
                      ____________________________________________________________
consensus TGGAAAATGTGCATCATCCTTTGTGTTTGTGGCTTCAACAACTTCGCTGCTTCGCATCAT
 
. : . : . : . : . : . :
rJMSF026D20- CTCGCTTCCTTCGTGACTGCCTTCTCTGGTCTGCCTTTTCTCTCCACCGTCACACGCCAT
JMFS106F06+ CTCGCTTCCTTCGTGACTGCCTTCTCTGGTCTGCCTTTTCTCTCCACCGTCACACGCCAT
JMSF026D20+ CTCGCTTCCTTCGTGACTGCCTTCTCTGGTCTGCCTTTTCTCTCCACCGTCACACGCCAT
JMFF032J01+ CTCGCTTCCTTCGTGACTGCCTTCTCTGGTCTGCCTTTTCTCTCCACCGTCACACGCCAT
JMFF050B13+ CTCGCTTCCTTCGTGACTGCCTTCTCTGGTCTGCCTTTTCTCTCCACCGTCACACGCCAT
                      ____________________________________________________________
consensus CTCGCTTCCTTCGTGACTGCCTTCTCTGGTCTGCCTTTTCTCTCCACCGTCACACGCCAT
 
. : . : . : . : . : . :
rJMSF026D20- CTCCGATCCACCGCTTCTCTCCACGGTCTCTAATCCACCTCTTCTCACCTTTACGGCTTC
JMFS106F06+ CTCCGATCCACCGCTTCTCTCCACGGTCTCTAATCCACCTCTTCTCACCTTTACGGCTTC
JMSF026D20+ CTCCGATCCACCGCTTCTCTCCACGGTCTCTAATCCACCTCTTCTCACCTTTACGGCTTC
JMFF032J01+ CTCCGATCCACCGCTTCTCTCCACGGTCTCTAATCCACCTCTTCTCACCTTTACGGCTTC
JMFF050B13+ CTCCGATCCACCGCTTCTCTCCACGGTCTCTAATCCACCTCTTCTCACCTTTACGGCTTC
                      ____________________________________________________________
consensus CTCCGATCCACCGCTTCTCTCCACGGTCTCTAATCCACCTCTTCTCACCTTTACGGCTTC
 
. : . : . : . : . : . :
rJMSF026D20- CTTCTCCGATCCACCGCACCATGCCAATCATTGCTACCCTCGCTGATTGTCGCTAGTCCT
JMFS106F06+ CTTCTCCGATCCACCGCACCATGCCAATCATTGCTACCCTCGCTGATTGTCGCTAGTCCT
JMSF026D20+ CTTCTCCGATCCACCGCACCATGCCAATCATTGCTACCCTCGCTGATTGTCGCTAGTCCT
JMFF032J01+ CTTCTCCGATCCACCGCACCATGCCAATCATTGCTACCCTCGCTGATTGTCGCTAGTCCT
JMFF050B13+ CTTCTCCGATCCACCGCACCATGCCAATCATTGCTACCCTCGCTGATTGTCGCTAGTCCT
                      ____________________________________________________________
consensus CTTCTCCGATCCACCGCACCATGCCAATCATTGCTACCCTCGCTGATTGTCGCTAGTCCT
 
. : . : . : . : . : . :
rJMSF026D20- TTAATTCTGTCTG-AATCGTGATTTTGAACTT
JMFS106F06+ TTAATTCTGTCTGAAATCGTGATTTTGAACTTTCGCAATGTAGGGTTTCTTTAGTCAAAA
JMSF026D20+ TTAATTCTGTCTGAAATCGTGATTTTGAACTTTCGCAATGTAGGGTTTCTTTAGTCAAAA
JMFF032J01+ TTAATTCTGTCTGAAATCGTGATTTTGAACTTTCGCAATGTAGGGTTTCTTTAGTCAAAA
JMFF050B13+ TTAATTCTGTCTGAAATCGTGATTTTGAACTTTCGCAATGTAGGGTTTCTTTAGTCAAAA
                      ____________________________________________________________
consensus TTAATTCTGTCTGAAATCGTGATTTTGAACTTTCGCAATGTAGGGTTTCTTTAGTCAAAA
 
. : . : . : . : . : . :
JMFS106F06+ ACAGTAACGACTTCCGAATCAAACGCAAGTATTGTGTAATTTTTGGGGTCTTGTGGATTA
JMSF026D20+ ACAGTAACGACTTCCGAATCAAACGCAAGTATTGTGTAATTTTTGGGGTCTTGTGGATTA
JMFF032J01+ ACAGTAACGACTTCCGAATCAAACGCAAGTATTGTGTAATTTTTGGGGTCTTGTGGATTA
JMFF050B13+ ACAGTAACGACTTCCGAATCAAACGCAAGTATTGTGTAATTTTTGGGGTCTTGTGGATTA
                      ____________________________________________________________
consensus ACAGTAACGACTTCCGAATCAAACGCAAGTATTGTGTAATTTTTGGGGTCTTGTGGATTA
 
. : . : . : . : . : . :
JMFS106F06+ TTTGGGAAGTATAAAGACGATTTAGAGTTTGATTTTGGAAGGGTGGAGCGAAATTGCTAG
JMSF026D20+ TTTGGGAAGTATAAAGACGATTTAGAGTTTGATTTTGGAAGGGTGGAGCGAAATTGCTAG
JMFF032J01+ TTTGGGAAGTATAAAGACGATTTAGAGTTTGATTTTGGAAGGGTGGAGCGAAATTGCTAG
JMFF050B13+ TTTGGGAAGTATAAAGACGATTTAGAGTTTGATTTTGGAAGGGTGGAGCGAAATTGCTAG
                      ____________________________________________________________
consensus TTTGGGAAGTATAAAGACGATTTAGAGTTTGATTTTGGAAGGGTGGAGCGAAATTGCTAG
 
. : . : . : . : . : . :
JMFS106F06+ AAAACAAAGTAGAGAGATATGAACAGAGATGCTGAACGA
JMSF026D20+ AAAACAAAGTAGAGAGGTATGAACAGAGATGCTGAACGAGGAATTAAGGTAAAGAACC
JMFF032J01+ AAAACAAAGTAGAGAGATATGAACAGAGATGCTGAACGAGGAATTAAG
JMFF050B13+ AAAACAAAGTAGAGAGATATGAACAGAGATGCTGAACGAGGAATTAAGGTAAAGAACCGG
                      ____________________________________________________________
consensus AAAACAAAGTAGAGAGATATGAACAGAGATGCTGAACGAGGAATTAAGGTAAAGAACCGG