Previous Contig 002134:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037L17Sequence415002134 (4)357002134 (4)
JMFF050B09Sequence621002134 (4)624021882gb:AE016959_10227831e-36Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AE01
JMFS036H03Sequence620002134 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS036H03+ AAGAAGCATAAAGATCAGTCTTCTAGGTCTTTCACATACAAAAGACCCAGTANAACT
                      ____________________________________________________________
consensus AAGAAGCATAAAGATCAGTCTTCTAGGTCTTTCACATACAAAAGACCCAGTANAACT
 
. : . : . : . : . : . :
JMFS036H03+ GACCCCCAAGCAATATTTTCATGTAAATTGATGGAAATGCAATAGGCAAAATGTAAACTT
                      ____________________________________________________________
consensus GACCCCCAAGCAATATTTTCATGTAAATTGATGGAAATGCAATAGGCAAAATGTAAACTT
 
. : . : . : . : . : . :
JMFS036H03+ TTATCTCATTTTATTTGGAATAATTTGATTAAAATTAAGTTTAAAGCTCCAAAGAAAGTA
                      ____________________________________________________________
consensus TTATCTCATTTTATTTGGAATAATTTGATTAAAATTAAGTTTAAAGCTCCAAAGAAAGTA
 
. : . : . : . : . : . :
JMFS036H03+ CCTTTATGAGATACAACATGACAAATTAAAAAATGAAGCTAATCCATTTAAACAGAATTG
                      ____________________________________________________________
consensus CCTTTATGAGATACAACATGACAAATTAAAAAATGAAGCTAATCCATTTAAACAGAATTG
 
. : . : . : . : . : . :
JMFS036H03+ ACATACAGTAATTGCATCCAAAGCTTAAATAGAACATTAGAGTAATCTCCAATTTCCTTA
                      ____________________________________________________________
consensus ACATACAGTAATTGCATCCAAAGCTTAAATAGAACATTAGAGTAATCTCCAATTTCCTTA
 
. : . : . : . : . : . :
JMFS036H03+ CTTGAAAATGCAATAAATCACCAAATCAGCCCCTTATTTGATAAATTTATGATAGCTTAC
                      ____________________________________________________________
consensus CTTGAAAATGCAATAAATCACCAAATCAGCCCCTTATTTGATAAATTTATGATAGCTTAC
 
. : . : . : . : . : . :
JMFS036H03+ CTTACAGATCCAATGAAAACACACAAAATATACACCTAAAAAGCAAAGATCCAGAGAATC
JMFF050B09+ AAAAAGCAAAGATCCAGAGAATC
                      ____________________________________________________________
consensus CTTACAGATCCAATGAAAACACACAAAATATACACCTAAAAAGCAAAGATCCAGAGAATC
 
. : . : . : . : . : . :
JMFS036H03+ AGACAATCAACACCATATCCAGCTATCCACACATTTAGATCCAGAGATCCAAGCACATCC
JMFF050B09+ AGACAATCAACACCATATCCAGCTATCCACACATTTAGATCCAGAGATCCAAGCACATCC
                      ____________________________________________________________
consensus AGACAATCAACACCATATCCAGCTATCCACACATTTAGATCCAGAGATCCAAGCACATCC
 
. : . : . : . : . : . :
JMFS036H03+ ACACCAATTAATCAAACAAAACACGTACAAAATCAAACCTAGAGAGAACCAAGCAGCAGA
JMFF050B09+ ACACCAATTAATCAAACAAAACACGTACAAAATCAAACCTAGAGAGAACCAAGCAGCAGA
                      ____________________________________________________________
consensus ACACCAATTAATCAAACAAAACACGTACAAAATCAAACCTAGAGAGAACCAAGCAGCAGA
 
. : . : . : . : . : . :
JMFS036H03+ AATCAGATCGAAAACCAAACACAAAACACTCATAACTCACGCAAACCTATTCCGCCATCC
rJMFF037L17- CTCATAACTCACGCAAACCTATTCCGACATCC
JMFF037L17+ TCATAACTCACGCAAACCTATTCCGACATCC
JMFF050B09+ AATCAGATCGAAAACCAAACACAAAACACTCATAACTCACGCAAACCTATTCCGCCATCC
                      ____________________________________________________________
consensus AATCAGATCGAAAACCAAACACAAAACACTCATAACTCACGCAAACCTATTCCGACATCC
 
. : . : . : . : . : . :
JMFS036H03+ GTACGGAACCAAATTGCAATATA
rJMFF037L17- GTACGGAACCAAATTCTAATATACCGGGCGGCCTCCGATTCATTTGATACAGGGCGGGAC
JMFF037L17+ GTACGGAACCAAATTTTAATATNCCGGGCGGCCTCCGATTCATTTGATACNGGGCGGGAC
JMFF050B09+ GTACGGAACCAAATTGCAATATACC--GCGGTCTCCGATTCAATTGATACAGGGCAGGAC
                      ____________________________________________________________
consensus GTACGGAACCAAATTGTAATATACCGGGCGGCCTCCGATTCATTTGATACAGGGCGGGAC
 
. : . : . : . : . : . :
rJMFF037L17- CTAAACTCGCCGAGGACGACGCGCAAACGCATCTATC
JMFF037L17+ CTAAACTCGCCGAGGNCGACGCGCAAACGCATNTATC
JMFF050B09+ CTAAACTCGCCGAGGACGACGCGCAAACGCATCTATCCCATACGGATTCGTACAAGACAG
                      ____________________________________________________________
consensus CTAAACTCGCCGAGGACGACGCGCAAACGCATCTATCCCATACGGATTCGTACAAGACAG
 
. : . : . : . : . : . :
JMFF050B09+ ACACAGCATGCACACACTCCTCCGGCGGCTTTCGAGCTGAGCCGGCCGTCGAGCGGCGGC
                      ____________________________________________________________
consensus ACACAGCATGCACACACTCCTCCGGCGGCTTTCGAGCTGAGCCGGCCGTCGAGCGGCGGC
 
. : . : . : . : . : . :
JMFF050B09+ GGCGCCGTGAAAGTCCCGACCTGCACCAAGCGAATCAGAGACCGCCGCAATGTCTGTGCC
                      ____________________________________________________________
consensus GGCGCCGTGAAAGTCCCGACCTGCACCAAGCGAATCAGAGACCGCCGCAATGTCTGTGCC
 
. : . : . : . : . : . :
JMFF050B09+ CTAAGAGCCACGAACGAATTCGCCACTGTTATATATACAGTTTCTGCATCTACAGTTATA
                      ____________________________________________________________
consensus CTAAGAGCCACGAACGAATTCGCCACTGTTATATATACAGTTTCTGCATCTACAGTTATA
 
. : . : . : . : . : . :
JMFF050B09+ TATATATATATATATATATXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXATCTG
                      ____________________________________________________________
consensus TATATATATATATATATATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATCTG
 
. : . : . : . : . : . :
JMFF050B09+ AAACACAGAGAGATTAAAAGAAAACAAGAAAAAGTGGTTATTTTAGGGATTTAGGGCTGT
                      ____________________________________________________________
consensus AAACACAGAGAGATTAAAAGAAAACAAGAAAAAGTGGTTATTTTAGGGATTTAGGGCTGT