Previous Contig 002132:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF050A14Sequence443002132 (2)gb:AF325013_17864673e-05Arabidopsis thaliana At1g17620 (At1g17620/F11A6_23) mRNA, complete cds.413002132 (2)gb:AF325013_17864672e-04Arabidopsis thaliana At1g17620 (At1g17620/F11A6_23) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050A14+ CCGGGCTGAAAACG
JMFF050A14- TTAAAGCCGCCGGGCTGAAAACG
                      ____________________________________________________________
consensus TTAAAGCCGCCGGGCTGAAAACG
 
. : . : . : . : . : . :
rJMFF050A14+ AAGAGAGTTGGTATCAGAGTAACTTGCGACGACATTCGCGTCGCTGCTCCGGCCAAAAAG
JMFF050A14- AAGAGAGTTGGTATCAGAGTAACTTGCGACGACATTCGCGTCGCTGCTCCGGCCAAAAAG
                      ____________________________________________________________
consensus AAGAGAGTTGGTATCAGAGTAACTTGCGACGACATTCGCGTCGCTGCTCCGGCCAAAAAG
 
. : . : . : . : . : . :
rJMFF050A14+ TCGCCGTGGAAAGCCCCCATTCCGAACGACAAGTGTAACGTTGATGTCAGGTTCAAGATT
JMFF050A14- TCGCCGTCGAAAGCCACCATTCCGAACGACAAGTGTAACGTTGATGTCAGGTTCAAGATC
                      ____________________________________________________________
consensus TCGCCGTGGAAAGCCCCCATTCCGAACGACAAGTGTAACGTTGATGTCAGGTTCAAGATT
 
. : . : . : . : . : . :
rJMFF050A14+ TGGAAATGGAACTTTTGAATACGAGTTTAAATTTCCAAAAAAAAAAAAAAAAACGGGTTG
JMFF050A14- TGGAAATGGAACTTTTGAATACGAGTTTAAATCTACAAAAAAAAAAAAAAAAACGGGTTG
                      ____________________________________________________________
consensus TGGAAATGGAACTTTTGAATACGAGTTTAAATTTCCAAAAAAAAAAAAAAAAACGGGTTG
 
. : . : . : . : . : . :
rJMFF050A14+ ATTTTTGTTCTACACAAACACAATAATTCTTTTTTTGTTAGAACAAAGAAGAATTTTGTT
JMFF050A14- ATTTTTGTTCTACACAAACACAATAATTCTTTTTTTGTTAGAACAAAGAAGAATTTTGTT
                      ____________________________________________________________
consensus ATTTTTGTTCTACACAAACACAATAATTCTTTTTTTGTTAGAACAAAGAAGAATTTTGTT
 
. : . : . : . : . : . :
rJMFF050A14+ GTAATGATACACATACACATATACACATACGTGTAATTGGGTTTTGTGCAGTGTTTAGGA
JMFF050A14- GTAATGATACACATACACATATACACATACGTGTAATTGGGTTTTGTGCAGTGTTTAGGA
                      ____________________________________________________________
consensus GTAATGATACACATACACATATACACATACGTGTAATTGGGTTTTGTGCAGTGTTTAGGA
 
. : . : . : . : . : . :
rJMFF050A14+ TTTGAAGGTGTGATTCCTGCTTTAGATATTGTGCTTTGTGGAAAAAAGTTTGTACAAATG
JMFF050A14- TTTGAAGGTGTGATTCCTGCTTTAGATATTGTGCTTTGTGGAAAAAAGTTTGTACAAATG
                      ____________________________________________________________
consensus TTTGAAGGTGTGATTCCTGCTTTAGATATTGTGCTTTGTGGAAAAAAGTTTGTACAAATG
 
. : . : . : . : . : . :
rJMFF050A14+ CCAAATTAAATTGTTGCAAGACTCAACTTGGTTTGCTTC
JMFF050A14- CCAAATTAAATTGTTGCAAGACTCAACTTGGTTTGCTTCXXXXXXXXXXXXXXXXXXXXG
                      ____________________________________________________________
consensus CCAAATTAAATTGTTGCAAGACTCAACTTGGTTTGCTTCNNNNNNNNNNNNNNNNNNNNG