Previous Contig 002125:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041L23Sequence647002125 (13)gb:AK117863_18158732e-43Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA622010160 (6)gb:BT006486_16393733e-50Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMFF049N03Sequence633002125 (13)gb:AK117863_18158739e-40Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA646010160 (6)gb:AB025613_15163732e-79Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K2I5.
JMFS024C12Sequence619002125 (13)gb:AK117863_18158733e-46Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS037H12Sequence621002125 (13)gb:AK117863_18158734e-45Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS038F11Sequence627002125 (13)gb:AK117863_18158733e-49Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS042B04Sequence627002125 (13)gb:AK117863_18158733e-49Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS091G05Sequence616002125 (13)gb:AK117863_18158732e-39Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS127F05Sequence611002125 (13)gb:BT006486_16393738e-38Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMFS135F04Sequence623002125 (13)gb:AK117863_18158735e-45Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS137B02Sequence623002125 (13)gb:AK117863_18158732e-40Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMFS158A08Sequence542002125 (13)gb:AK117863_18158733e-32Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA
JMSF020A02Sequence680002125 (13)gb:BT006486_16393734e-40Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops709010160 (6)gb:BT006486_16393736e-67Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops
JMSF048C05Sequence692002125 (13)gb:AK117863_18158732e-56Arabidopsis thaliana At1g79620 mRNA for unknown protein, complete cds, clone: RA753010160 (6)gb:BT006486_16393732e-75Arabidopsis thaliana At5g49760 gene, complete cds.>gb:AK117123_1815170 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF048C05+ GCTGAGCTGGAATCTCGCCCGAGAATTTGTTCCNTC
                      ____________________________________________________________
consensus GCTGAGCTGGAATCTCGCCCGAGAATTTGTTCCNTC
 
. : . : . : . : . : . :
JMFS042B04+ CATATCAAGACCAGGTGTGTTCCCGTCAGAGA
JMFS038F11+ CATATCAAGACCAGGTGTGTTCCCGTCAGAGA
JMSF020A02+ AAGCATATCAAGACCAGGTGTGTTCCCGTCAGAGA
JMSF048C05+ CAAAGTGAAAGTGTTTGGTTCCGACAAGCATATCAAGACCAGGTGTGTTCCCGTCAGAGA
JMFS024C12+ TTCCCGTCAGAGA
JMFS037H12+ GA
JMFS135F04+ GA
                      ____________________________________________________________
consensus CAAAGTGAAAGTGTTTGGTTCCGACAAGCATATCAAGACCAGGTGTGTTCCCGTCAGAGA
 
. : . : . : . : . : . :
JMFS042B04+ CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS038F11+ CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMSF020A02+ CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMSF048C05+ CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS024C12+ CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS037H12+ CGGGAATACTCCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS135F04+ CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS137B02+ GTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS091G05+ CCAAATCGAGCCAATAGAGTTCCGACAATT
JMFS127F05+ TCGAGCCAATAGAGTTCCGACAATT
JMFF041L23+ ATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
JMFF049N03+ CAGCCAAATCGAGCCAATAGAGTTCCGACAATT
                      ____________________________________________________________
consensus CGGGAATACTTCCAGTAAGCTGATTGTCAGCCAAATCGAGCCAATAGAGTTCCGACAATT
 
. : . : . : . : . : . :
JMFS042B04+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS038F11+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMSF020A02+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMSF048C05+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS024C12+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS037H12+ GACCCAAGGAAGNCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS135F04+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS137B02+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS091G05+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS127F05+ GACCCAAGNAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFS158A08+ GCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFF041L23+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
JMFF049N03+ GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
                      ____________________________________________________________
consensus GACCCAAGGAAGGCGGTATTGGCCCAATGAACTTGTTTAAATTCAGTGATAGATATTTCA
 
. : . : . : . : . : . :
JMFS042B04+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS038F11+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMSF020A02+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMSF048C05+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS024C12+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS037H12+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS135F04+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS137B02+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS091G05+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS127F05+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFS158A08+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFF041L23+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
JMFF049N03+ GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
                      ____________________________________________________________
consensus GCTTGCTCAAAGATCCTATCGAGTCTGGAATTAGTCCAAAAAACCCACACCCAACAAGGA
 
. : . : . : . : . : . :
JMFS042B04+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS038F11+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMSF020A02+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMSF048C05+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS024C12+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS037H12+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS135F04+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS137B02+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS091G05+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS127F05+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFS158A08+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFF041L23+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
JMFF049N03+ TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
                      ____________________________________________________________
consensus TTAGATTATACAACTTCTTTAAGTTTCCAATTTCCCGAGGAAGAGATCCTGTCAAATCTT
 
. : . : . : . : . : . :
JMFS042B04+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS038F11+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMSF020A02+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMSF048C05+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS024C12+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS037H12+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS135F04+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS137B02+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS091G05+ TGTTGTATGATAGATCAAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS127F05+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFS158A08+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFF041L23+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
JMFF049N03+ TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
                      ____________________________________________________________
consensus TGTTGTATGATAGATCCAGAATCTGCAACTCAGATAGCTCCTCGATGTCTCCAGAGAGCT
 
. : . : . : . : . : . :
JMFS042B04+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS038F11+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMSF020A02+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMSF048C05+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS024C12+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS037H12+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS135F04+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS137B02+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS091G05+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS127F05+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFS158A08+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFF041L23+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
JMFF049N03+ CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
                      ____________________________________________________________
consensus CACCAGTCAGATCCATGCTTGATAAAGTTAATGAAACCACTCTTGAACCGTTGCAACCAA
 
. : . : . : . : . : . :
JMFS042B04+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS038F11+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMSF020A02+ CTCC
JMSF048C05+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS024C12+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS037H12+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS135F04+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS137B02+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS091G05+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS127F05+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFS158A08+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFF041L23+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
JMFF049N03+ CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
                      ____________________________________________________________
consensus CTCCTTCCCAGTGATCACCACAAGGATCAGACCCTTCCGCCCAACTGGGAGGCACATTCT
 
. : . : . : . : . : . :
JMFS042B04+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS038F11+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMSF048C05+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS024C12+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS037H12+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS135F04+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS137B02+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS091G05+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS127F05+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFS158A08+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFF041L23+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
JMFF049N03+ TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
                      ____________________________________________________________
consensus TCCAACCATCTCGGAGGGCCTTTATAGCGACATAATCATTGTTATCTGTAAAAGCCACTA
 
. : . : . : . : . : . :
JMFS042B04+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS038F11+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMSF048C05+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS024C12+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS037H12+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS135F04+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS137B02+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS091G05+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS127F05+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFS158A08+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFF041L23+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
JMFF049N03+ TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
                      ____________________________________________________________
consensus TACCCAAAAATTGGATAAACAAAGGCACCAAAAGCAGCTGGATTCTTGGGATCATTGTTT
 
. : . : . : . : . : . :
JMFS042B04+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAAC
JMFS038F11+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAAC
JMSF048C05+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACC
JMFS024C12+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFS037H12+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAAACTCAA
JMFS135F04+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFS137B02+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFS091G05+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFS127F05+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFS158A08+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFF041L23+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
JMFF049N03+ ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
                      ____________________________________________________________
consensus ATCAAATGACCATACCACTCCAACAATCAAAACAAACAACTTCTTGAACAAGAACCTCAA
 
. : . : . : . : . : . :
JMFS024C12+ ACCTTA
JMFS037H12+ ACCTTAATCACTCCTCCAA
JMFS135F04+ ACCTTAATCACTCCTCCAAGT
JMFS137B02+ ACCTTAATCACTCCTCCAAGTTCTTAGCACTGTGTTTTT
JMFS091G05+ ACCTTAATCACTCCTCCAAGTTCTTAGCACTGTGTTTTT
JMFS127F05+ ACCTTAATCACTCCTCCAAGTTCTTAGCACTGTGTTTT
JMFS158A08+ ACCTTAATCACTCCTCCAAGTTC
JMFF041L23+ ACCTTAATCACTCCTCCAAGTTCTTAGCACTGTGTTTTT
JMFF049N03+ ACCTTAATCACTCCTCCAAGTTCTTAGCACTGTGTTTTTGAGGTTCTCTCTTTTGTTTTC
                      ____________________________________________________________
consensus ACCTTAATCACTCCTCCAAGTTCTTAGCACTGTGTTTTTGAGGTTCTCTCTTTTGTTTTC