Previous Contig 002118:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049J19Sequence600002118 (2)gb:AY074568_15676083e-07Arabidopsis thaliana AT5g42350/MDH9_4 mRNA, complete cds.622011040 (2)gb:AB016888_15131606e-30Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDH9.>gb:AY143953_15834
JMFF050O15Sequence599002118 (2)gb:AY074568_15676082e-08Arabidopsis thaliana AT5g42350/MDH9_4 mRNA, complete cds.571011040 (2)gb:AB016888_15131603e-18Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MDH9.>gb:AY143953_15834

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050O15+ CTCATCGCGTGGGA
JMFF049J19+ A
                      ____________________________________________________________
consensus CTCATCGCGTGGGA
 
. : . : . : . : . : . :
JMFF050O15+ GATGCAATTCATGACAGATTCCTCGTATGCCACATACCCTTTGCTTTCGTCACTTGCACT
JMFF049J19+ GATGCAATTCATGACAGATTCCTCGTATGACACATACCC-TTGCTTTCGTCACTTGCACT
                      ____________________________________________________________
consensus GATGCAATTCATGACAGATTCCTCGTATGCCACATACCCTTTGCTTTCGTCACTTGCACT
 
. : . : . : . : . : . :
JMFF050O15+ CGACCATCTTCTAGCTTGTGGGTCCTCAAGATCTCTGTCCATGTCAGCACTCACTTTACA
JMFF049J19+ CGACCATCTTCTAGCTTGTGGGTCCTCAAGATCTCTGTCCATGTCAGCACTCACTTTACA
                      ____________________________________________________________
consensus CGACCATCTTCTAGCTTGTGGGTCCTCAAGATCTCTGTCCATGTCAGCACTCACTTTACA
 
. : . : . : . : . : . :
JMFF050O15+ ACCCCCGCCCCTACCGTAAAGACTAAGACAACTCAGGGAAACACCCCTAGCATTGTCCCG
JMFF049J19+ ACCCCCGCCCCTACCGTAAAGACTAAGACAACTCAGGGAAACACCCCTAGCATTGTCCCG
                      ____________________________________________________________
consensus ACCCCCGCCCCTACCGTAAAGACTAAGACAACTCAGGGAAACACCCCTAGCATTGTCCCG
 
. : . : . : . : . : . :
JMFF050O15+ TTCCTCCTCTTCACCCTTGTGGCTCTTCCGTTTTAACTTCTGGCTTACACTTCTGACTAG
JMFF049J19+ TTCCTCCTCTTCACCCTTGTGGCTCTTCCGTTTTAACTTCTGGCTTACACTTCTGACTAG
                      ____________________________________________________________
consensus TTCCTCCTCTTCACCCTTGTGGCTCTTCCGTTTTAACTTCTGGCTTACACTTCTGACTAG
 
. : . : . : . : . : . :
JMFF050O15+ ACGTTTTGACACACTCAATGGTTCAAAATTCCGCAGAAGAGATTCTCCCCTTTCGGGCTT
JMFF049J19+ ACGTTTTGACACACTCAATGGTTCAAAATTCCGCAGAAGAGATTCTCCCCTTTCGGGCTT
                      ____________________________________________________________
consensus ACGTTTTGACACACTCAATGGTTCAAAATTCCGCAGAAGAGATTCTCCCCTTTCGGGCTT
 
. : . : . : . : . : . :
JMFF050O15+ CTCAGACATGATGCTCCCAAACCCAAACTCTCATCAAACAGTACAAGTAATGCATCAATG
JMFF049J19+ CTCAGACATGATGCTCCCAAACCCAAACTCTCATCAAACAGTACAAGTAATGCATCAATG
                      ____________________________________________________________
consensus CTCAGACATGATGCTCCCAAACCCAAACTCTCATCAAACAGTACAAGTAATGCATCAATG
 
. : . : . : . : . : . :
JMFF050O15+ TTCCGTTGAAATCAAATCCCCACAGCTCCAAGCACGATTTGATCCCAGATCACGATTCAT
JMFF049J19+ TTCCGTTGAAATCAAATCCCCACAGCTCCAAGCACGATTTGATCCCAGATCACGATTCAT
                      ____________________________________________________________
consensus TTCCGTTGAAATCAAATCCCCACAGCTCCAAGCACGATTTGATCCCAGATCACGATTCAT
 
. : . : . : . : . : . :
JMFF050O15+ TGCTGGGAATATAGAACATTAATTGAAGATCTCATCACCATGAATATCTGCAATTTAAGC
JMFF049J19+ TGCTGGGAATATAGAACATTAATTGAAGATCTCATCACCATGAATATCTGCAATTTAAGC
                      ____________________________________________________________
consensus TGCTGGGAATATAGAACATTAATTGAAGATCTCATCACCATGAATATCTGCAATTTAAGC
 
. : . : . : . : . : . :
JMFF050O15+ TTCAAGAAAGA
JMFF049J19+ TTCAAGAAAGAAGCTAAAACATCATGATCAGAACATTGAACAAAAAGAGAAGGAAATTAT
                      ____________________________________________________________
consensus TTCAAGAAAGAAGCTAAAACATCATGATCAGAACATTGAACAAAAAGAGAAGGAAATTAT
 
. : . : . : . : . : . :
JMFF049J19+ ATAATTTCTTGAAGGGGGTTTCTTACTTTCTTCTCGTTTTTATTATGTTGGTTGGAATTT
                      ____________________________________________________________
consensus ATAATTTCTTGAAGGGGGTTTCTTACTTTCTTCTCGTTTTTATTATGTTGGTTGGAATTT