Previous Contig 002116:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049J12Sequence615002116 (2)gb:AF434681_17997057e-42Arabidopsis thaliana arogenate dehydrogenase mRNA, complete cds.359010917 (2)gb:AY123984_15800662e-06Arabidopsis thaliana At1g15710/F7H2_5 mRNA, complete cds.>gb:BT000566_1634844 Ar
JMSF004O15Sequence219002116 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049J12+ AGCCAAGTCTTTCCA
                      ____________________________________________________________
consensus AGCCAAGTCTTTCCA
 
. : . : . : . : . : . :
JMFF049J12+ CCCATCTCTCCCGCTTTCTGGTCCAAACATCGGGTGAGTGCAGAGCAAGTCCGAGTCCTC
                      ____________________________________________________________
consensus CCCATCTCTCCCGCTTTCTGGTCCAAACATCGGGTGAGTGCAGAGCAAGTCCGAGTCCTC
 
. : . : . : . : . : . :
JMFF049J12+ GGGCAACACCTGCAGAAGGATATCTCTGGGGTGTTCTTTTACTGACAGTACGTCGACAAA
                      ____________________________________________________________
consensus GGGCAACACCTGCAGAAGGATATCTCTGGGGTGTTCTTTTACTGACAGTACGTCGACAAA
 
. : . : . : . : . : . :
JMFF049J12+ GAGTGTTTGCCGTCTCAGGCAATGAAATGGCATAGACTTGACAACTTGTTTTAGCGACAG
                      ____________________________________________________________
consensus GAGTGTTTGCCGTCTCAGGCAATGAAATGGCATAGACTTGACAACTTGTTTTAGCGACAG
 
. : . : . : . : . : . :
JMFF049J12+ GATTGATGTGCATATAAGTATAGCATCATTGTCTGATTCGAAAAGCGCAGCCATATCCCT
                      ____________________________________________________________
consensus GATTGATGTGCATATAAGTATAGCATCATTGTCTGATTCGAAAAGCGCAGCCATATCCCT
 
. : . : . : . : . : . :
JMFF049J12+ GTAGAATGATGCTATTCCGAGATGTTTGCAGACTTCTGAGTAATCTGATCTCGAAGATGC
                      ____________________________________________________________
consensus GTAGAATGATGCTATTCCGAGATGTTTGCAGACTTCTGAGTAATCTGATCTCGAAGATGC
 
. : . : . : . : . : . :
JMFF049J12+ TGTTATGGAATGGCCTTGTTTGATCATGGTTTTTGCCAGGAACTGGGCGAAAGGGCCAAA
                      ____________________________________________________________
consensus TGTTATGGAATGGCCTTGTTTGATCATGGTTTTTGCCAGGAACTGGGCGAAAGGGCCAAA
 
. : . : . : . : . : . :
JMSF004O15+ TCATGGTTTGTTTCTGATGATGACAAAGAACAAGTAGACATGA
JMFF049J12+ CCCAACAATTCCAATCTTCATGGTTTGTTTCTGATGATGACAAAGAACAAGTAGACATGA
                      ____________________________________________________________
consensus CCCAACAATTCCAATCTTCATGGTTTGTTTCTGATGATGACAAAGAACAAGTAGACATGA
 
. : . : . : . : . : . :
JMSF004O15+ GAGAAAAATGATGTGTTGATGAGGTTTTAAGGTAACACTAAACTGTAGTGATATGTATTG
JMFF049J12+ GAGAAAAATGATGTGTTGATGAGGTTTTAAGGTAACACTAAACTGTAGTGATATGTATTG
                      ____________________________________________________________
consensus GAGAAAAATGATGTGTTGATGAGGTTTTAAGGTAACACTAAACTGTAGTGATATGTATTG
 
. : . : . : . : . : . :
JMSF004O15+ TCTGGAATGGGAGATCCTTGCACGTCTCTTCTTAGCAAAGGTTGGGGATCGGATATGGTT
JMFF049J12+ TCTGGAATGGGAGATCCTTGCACGTCTCTTCTTAGCAAAGGTTGGGGATCGGATATGGTT
                      ____________________________________________________________
consensus TCTGGAATGGGAGATCCTTGCACGTCTCTTCTTAGCAAAGGTTGGGGATCGGATATGGTT
 
. : . : . : . : . : . :
JMSF004O15+ GATCCATTGGCACTTGGCAGATGCTGAGTAGAGTCTCACCCTCTCAGCTCAGC
JMFF049J12+ GATCCATTGGCACTTGGCAGATGCTGAGTAGAGTCTCACCCTCTCAGCTCAGCTCAAATT
                      ____________________________________________________________
consensus GATCCATTGGCACTTGGCAGATGCTGAGTAGAGTCTCACCCTCTCAGCTCAGCTCAAATT