Previous Contig 002112:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019O24Sequence508002112 (5)gb:AB025631_15165711e-08Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPN9.693009137 (5)
JMFF025E11Sequence306002112 (5)gb:AC135207_17420483e-04Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1261C08, complete se783009137 (5)gb:AE016959_10231772e-39Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFF025O18Sequence290002112 (5)gb:AC135207_17420483e-04Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1261C08, complete se709009137 (5)gb:AE016959_10231775e-50Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC08
JMFF047A21Sequence458002112 (5)gb:AC135207_17420483e-04Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1261C08, complete se398009137 (5)
JMFF049H12Sequence618002112 (5)gb:AB025631_15165712e-14Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MPN9.187009137 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049H12+ ATCATTTTCCATAAGCTGT
                      ____________________________________________________________
consensus ATCATTTTCCATAAGCTGT
 
. : . : . : . : . : . :
JMFF019O24+ TCCGAGATTCCCCGGAACCCCT
JMFF049H12+ TGGATCAACTGTTCGAGCCCAGGACCGACGAAGTAATCTCCGAGATTCCCCGGAACCCCT
                      ____________________________________________________________
consensus TGGATCAACTGTTCGAGCCCAGGACCGACGAAGTAATCTCCGAGATTCCCCGGAACCCCT
 
. : . : . : . : . : . :
JMFF019O24+ CCACCACCGCCACTGTTTTCAAAAACCAATTGAATATTAGCACCGCTAGCCCTCATGGTC
JMFF047A21+ TCATGGTC
JMFF049H12+ CCACCACCGCCACTGTTTNCAAAAACCAATTGAATATTAGCACCGCTAGCCCTCATGGTC
                      ____________________________________________________________
consensus CCACCACCGCCACTGTTTTCAAAAACCAATTGAATATTAGCACCGCTAGCCCTCATGGTC
 
. : . : . : . : . : . :
JMFF019O24+ TGCAAATAGTTCTGGAGGAAAAGAAGGGGATGGAATTGATTTGGGGATCGGCCGGCAGCC
JMFF047A21+ TGCAAATAGTTCTGGAGGAAAAGAAGGGGATGGAATTGATTTGGGGATCGGCCGGCAGCC
JMFF049H12+ TGCAAATAGTTCTGGAGGAAAAGAAGGGGATGGAATTGATTTGGGGATCGGCCGGCAGCC
                      ____________________________________________________________
consensus TGCAAATAGTTCTGGAGGAAAAGAAGGGGATGGAATTGATTTGGGGATCGGCCGGCAGCC
 
. : . : . : . : . : . :
JMFF019O24+ ATACCACCGAACAAAGCAGAAAGATCATCAAGCGCAATCCCACCGCCGGAGGAGGCCGTG
JMFF047A21+ ATACCACCGAACAAAGCAGAAAGATCATCAAGCGCAATCCCACCGCCGGAGGAGGCCGTG
JMFF049H12+ ATACCACCGAACAAAGCAGAAAGATCATCAAGCGCAATCCCACCGCCGGAGGAGGCCGTG
                      ____________________________________________________________
consensus ATACCACCGAACAAAGCAGAAAGATCATCAAGCGCAATCCCACCGCCGGAGGAGGCCGTG
 
. : . : . : . : . : . :
JMFF019O24+ GAGAACACAAGGCCCTCCCCTCCNTTCTCCTACTCCTCCTCCACCGCCGAAGCCAAAAGG
JMFF047A21+ GAGAACACAAGGCCCTCCCCTCC-TCCTCCTACTCCTCCTCCACCGCCGAAGCCAAAAGG
JMFF025O18+ CTACTCCTCCTCCACCGCCGAAGCCAAAAGG
JMFF025E11+ CTCCTACTCCTCCTCCACCGCCGAAGCCAAAAGG
JMFF049H12+ GAGAACACAAGGCCCTCCCCTCC-TCCTCCTACTCCTCCTCCACCGCCGAAGCCAAAAGG
                      ____________________________________________________________
consensus GAGAACACAAGGCCCTCCCCTCC-TCCTCCTACTCCTCCTCCACCGCCGAAGCCAAAAGG
 
. : . : . : . : . : . :
JMFF019O24+ AAACGCATCGGCGCCGGGGAAGAAGGGATTATTGTTGCTAGGGTTTGTAGGCGGGGCGGT
JMFF047A21+ AAACGCATCGGCGCCGGGGAAGAAGGGATTATTGTTGCTAGGGTTTGTAGGCGGGGCGGT
JMFF025O18+ AAACGCATCGGCGCCGGGGAAGAAGGGATTATTGTTGCTAGGGTTTGTAGGCGGGGCGGT
JMFF025E11+ AAACGCATCGGCGCCGGGGAAGAAGGGATTATTGTTGCTAGGGTTTGTAGGCGGGGCGGT
JMFF049H12+ AAACGCATCGGCGCCGGGGAAGAAGGGATTATTGTTGCTAGGGTTTGTAGGCGGGGCGGT
                      ____________________________________________________________
consensus AAACGCATCGGCGCCGGGGAAGAAGGGATTATTGTTGCTAGGGTTTGTAGGCGGGGCGGT
 
. : . : . : . : . : . :
JMFF019O24+ TTCGGCTTCTTCAAGAAAGTTGCCGTTGCAATTAGGGCAGACGAGTTCGGAGTTGGGCAA
JMFF047A21+ TTCGGCTTCTTCAAGAAAGTTGCCGTTGCAATTAGGGCAGACGAGTTCGGAGTTGGGCAA
JMFF025O18+ TTCGGCTTCTTCAAGAAAGTTGCCGTTGCAATTAGGGCAGACGAGTTCGGAGTTGGGCAA
JMFF025E11+ TTCGGCTTCTTCAAGAAAGTTGCCGTTGCAATTAGGGCAGACGAGTTCGGAGTTGGGCAA
JMFF049H12+ TTCGGCTTCTTCAAGAAAGTTGCCGTTGCAATTAGGGCAGACGAGTTCGGAGTTGGGCAA
                      ____________________________________________________________
consensus TTCGGCTTCTTCAAGAAAGTTGCCGTTGCAATTAGGGCAGACGAGTTCGGAGTTGGGCAA
 
. : . : . : . : . : . :
JMFF019O24+ GGGGGTAATCGTCACCGTCCGCTCGCAATGGTAGCAGAAGTAATCCTGCGGCCCGCCGCC
JMFF047A21+ GGGGGTAATCGTCACCGTCCGCTCGCAATGGTAGCAGAAGTAATCCTGCGGCCCGCCGCC
JMFF025O18+ GGGGGTAATCGTCACCGTCCGCTCGCAATGGTAGCAGAAGTAATCCTGCGGCCCGCCGCC
JMFF025E11+ GGGGGTAATCGTCACCGTCCGCTCGCAATGGTAGCAGAAGTAATCCTGCGGCCCGCCGCC
JMFF049H12+ GGGGGTAATCGTCACCGTCCGCTCGCAATGGTAGCAGAAGTAATCCTGCGGCCCGCCGCC
                      ____________________________________________________________
consensus GGGGGTAATCGTCACCGTCCGCTCGCAATGGTAGCAGAAGTAATCCTGCGGCCCGCCGCC
 
. : . : . : . : . : . :
JMFF019O24+ GCGACCGACTCCTTCTCCACCGCCACCAGAAATTCCGGCATGCGACATTTTCCGTGTTCG
JMFF047A21+ GCGACCGACTCCTTCTCCACCGCCACCAGAAATTCCGGCATGCGACATTTTCCGTGTTCG
JMFF025O18+ GCGACCGACTCCTTCTCCACCGCCACCAGAAATTCCGGCATGCGACATTTTCCGTGTTCG
JMFF025E11+ GCGACCGACTCCTTCTCCACCGCCACCAGAAATTCCGGCATGCGACATTTTCCGTGTTCG
JMFF049H12+ GCGACCGACTCCTTCTCCACCGCCACCAGAAATTCCGGCATGCGACATTTTCCGTGTTCG
                      ____________________________________________________________
consensus GCGACCGACTCCTTCTCCACCGCCACCAGAAATTCCGGCATGCGACATTTTCCGTGTTCG
 
. : . : . : . : . : . :
JMFF019O24+ ATTGAC
JMFF047A21+ ATTGACAAGAAACGCCTCCAAGTT
JMFF025O18+ ATTGACAAGAAACGCCTCC
JMFF025E11+ ATTGACAAGAAACGCCTCCAAGTT
JMFF049H12+ ATTGACAAGAAACGCCTCCAAGTTGAAATGAATAGAAAAAGAGGAATAGTCGGACCCCGG
                      ____________________________________________________________
consensus ATTGACAAGAAACGCCTCCAAGTTGAAATGAATAGAAAAAGAGGAATAGTCGGACCCCGG