Previous Contig 002110:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049G14Sequence646002110 (3)gb:SOL6940_17158191e-53Spinacia oleracea mRNA for phosphoribosyl pyrophosphate synthase, isozyme 1.656021861gb:AY127024_15804781e-42Arabidopsis thaliana At2g44530/F16B22.2 mRNA, complete cds.>gb:BT001041_1635296
JMSF027C21Sequence649002110 (3)gb:SOL6940_1715819e-106Spinacia oleracea mRNA for phosphoribosyl pyrophosphate synthase, isozyme 1.746002110 (3)gb:AY127024_15804783e-95Arabidopsis thaliana At2g44530/F16B22.2 mRNA, complete cds.>gb:BT001041_1635296

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF027C21- TA
                      ____________________________________________________________
consensus TA
 
. : . : . : . : . : . :
rJMSF027C21- GCCACCCGGAAGCTCCTTTTACACTAACTATAACCAAATTTACAGTAAAGGAGGAATATG
                      ____________________________________________________________
consensus GCCACCCGGAAGCTCCTTTTACACTAACTATAACCAAATTTACAGTAAAGGAGGAATATG
 
. : . : . : . : . : . :
rJMSF027C21- CTTCAGTTCAGGTGAAAATCTGTTTGGTTTATGTTATCCCTTCAAATTGAGATTCTTAAG
                      ____________________________________________________________
consensus CTTCAGTTCAGGTGAAAATCTGTTTGGTTTATGTTATCCCTTCAAATTGAGATTCTTAAG
 
. : . : . : . : . : . :
rJMSF027C21- GATAGCTATAGAGAAAGAGCAAGAAACGGAGCACCTTCAGACTTAATCAATCAATGCCCA
                      ____________________________________________________________
consensus GATAGCTATAGAGAAAGAGCAAGAAACGGAGCACCTTCAGACTTAATCAATCAATGCCCA
 
. : . : . : . : . : . :
rJMSF027C21- GGCTTGAGTAAGGCTCAAAACCACCAGCGCAATCATCATGAACACGCCATATGGTTTCTC
                      ____________________________________________________________
consensus GGCTTGAGTAAGGCTCAAAACCACCAGCGCAATCATCATGAACACGCCATATGGTTTCTC
 
. : . : . : . : . : . :
rJMSF027C21- CCAGGAGGTTTGCAACAGACAGCACGGTCAACTCAGGAAAGTAATTCTGCTCTGCAACAG
                      ____________________________________________________________
consensus CCAGGAGGTTTGCAACAGACAGCACGGTCAACTCAGGAAAGTAATTCTGCTCTGCAACAG
 
. : . : . : . : . : . :
rJMSF027C21- GAATGGTATTTGTGACAATTACCTCTTGAAAGAGGCCACTTGATAACCTCTCTATTGCAG
                      ____________________________________________________________
consensus GAATGGTATTTGTGACAATTACCTCTTGAAAGAGGCCACTTGATAACCTCTCTATTGCAG
 
. : . : . : . : . : . :
rJMSF027C21- GAGGGCTGAAAACAGCATGAGTGCTGCATGCATACACCTCCCTTGCTCCCTCTTGATGTA
                      ____________________________________________________________
consensus GAGGGCTGAAAACAGCATGAGTGCTGCATGCATACACCTCCCTTGCTCCCTCTTGATGTA
 
. : . : . : . : . : . :
rJMSF027C21- ATAGTGCAGCTCCTTTGGCAATAGTACCAGCAGTATCAATCATGTCATCAACCATAACTG
                      ____________________________________________________________
consensus ATAGTGCAGCTCCTTTGGCAATAGTACCAGCAGTATCAATCATGTCATCAACCATAACTG
 
. : . : . : . : . : . :
rJMSF027C21- CTACCTTTCCCCTGACGTCACCAATCAAATTCATTACCTCAGCAACATTGTGTGCATAGC
                      ____________________________________________________________
consensus CTACCTTTCCCCTGACGTCACCAATCAAATTCATTACCTCAGCAACATTGTGTGCATAGC
 
. : . : . : . : . : . :
rJMSF027C21- GCCTTTTATCCACGATGGCTAGAGGTGCATCAGACAACTTTTTGGCAAAAGCCCGTGCCC
JMSF027C21+ CACGATGGCTAGAGGTGCATCAGACAACTTTTTGGCAAAAGCCCGTGCCC
                      ____________________________________________________________
consensus GCCTTTTATCCACGATGGCTAGAGGTGCATCAGACAACTTTTTGGCAAAAGCCCGTGCCC
 
. : . : . : . : . : . :
rJMSF027C21- TTGCAACTCCACCAACATCCGGCGACACCACAACCAAATCATCAGAACAGATAGTCTTGC
JMSF027C21+ TTGCAACTCCACCAACATCCGGCGACACCACAACCAAATCATCAGAACAGATAGTCTTGC
                      ____________________________________________________________
consensus TTGCAACTCCACCAACATCCGGCGACACCACAACCAAATCATCAGAACAGATAGTCTTGC
 
. : . : . : . : . : . :
rJMSF027C21- TGGCAAGATAATCAAGTATAACAGGCTGACCATGTACATGGTCCACTGGAATGTCAAAAT
JMSF027C21+ TGGCAAGATAATCAAGTATAACAGGCTGACCATGTACATGGTCCACTGGAATGTCAAAAT
                      ____________________________________________________________
consensus TGGCAAGATAATCAAGTATAACAGGCTGACCATGTACATGGTCCACTGGAATGTCAAAAT
 
. : . : . : . : . : . :
rJMSF027C21- AGCCCATGGACTGGCCAGAATGAA
JMSF027C21+ AGCCCATGGACTGGCCAGAATGAAGATCACAAGCAAGAACACGGTCAGCACCAGCTTCAG
JMFF049G14+ CCAGAATGAATATCACAAGCAAGAACTCTATCCGCACCAGCTTCAG
                      ____________________________________________________________
consensus AGCCCATGGACTGGCCAGAATGAATATCACAAGCAAGAACTCTGTCCGCACCAGCTTCAG
 
. : . : . : . : . : . :
JMSF027C21+ TAATCAGATTAGCAACAAGTTTGGCTGCAATGGATTCACGGCCTTGAGTCTTCCGATCAG
JMFF049G14+ TAATCAGATTTGCTACGAGTTTGGCTGCAATGGAATCATGACCTTCAGTCTT---ATCAG
                      ____________________________________________________________
consensus TAATCAGATTTGCTACGAGTTTGGCTGCAATGGATTCATGGCCTTGAGTCTTCCGATCAG
 
. : . : . : . : . : . :
JMSF027C21+ CTCGAGCATAACCAAAGTAAGGAATAACTGCAGTAATATTTTTGGCAGAGGCTCTGCGAC
JMFF049G14+ CTCGGCCATAGCCAAAGTAAGGAATTACTGCAGTAATACTTTTTGCAGAGGCCCTTCGAC
                      ____________________________________________________________
consensus CTCGGGCATAGCCAAAGTAAGGAATTACTGCAGTAATATTTTTTGCAGAGGCTCTTCGAC
 
. : . : . : . : . : . :
JMSF027C21+ AAGCATCAATCATTATCAAGAGCTCCATAAGATTTTCATTTGCAGGAGGACAAGTAGGTT
JMFF049G14+ TAGCATCAATCATTATCAGAAGCTCCATAAGATTTTCATTTGCAGGAGGGCAAGAAGGTT
                      ____________________________________________________________
consensus TAGCATCAATCATTATCAGGAGCTCCATAAGATTTTCATTTGCAGGAGGGCAAGTAGGTT
 
. : . : . : . : . : . :
JMSF027C21+ GCACAAGATATACATCACAACCTCTGACACTTTCTTGTAACTGGACATATATTTCACCAT
JMFF049G14+ GAACAAGACATACATCACAACCTCTGATGCTTTCTTGGAACTGAACATAAATTTCACCAT
                      ____________________________________________________________
consensus GCACAAGATATACATCACAACCTCTGATGCTTTCTTGTAACTGGACATATATTTCACCAT
 
. : . : . : . : . : . :
JMSF027C21+ CAGCAAAACGTTT
JMFF049G14+ CAGCAAAACGTTTTATCAGGACTCTTCCAAGTTGTAAACCCATGTAAGTCGCAATTCCCT
                      ____________________________________________________________
consensus CAGCAAAACGTTTTATCAGGACTCTTCCAAGTTGTAAACCCATGTAAGTCGCAATTCCCT
 
. : . : . : . : . : . :
JMFF049G14+ GAGCAAGTGCACGATTAGCCGTCCCAGAAAAAAATCCGGAGCCTGTCTTTCTGTTTCTGC
                      ____________________________________________________________
consensus GAGCAAGTGCACGATTAGCCGTCCCAGAAAAAAATCCGGAGCCTGTCTTTCTGTTTCTGC
 
. : . : . : . : . : . :
JMFF049G14+ TGAACAATAAGTCTCTGGAGCTGATCGGAAGTCAGGGAGGTCAGAAGCTTCTGAATACGA
                      ____________________________________________________________
consensus TGAACAATAAGTCTCTGGAGCTGATCGGAAGTCAGGGAGGTCAGAAGCTTCTGAATACGA
 
. : . : . : . : . : . :
JMFF049G14+ ACACTGTCAGCCAGGCTAGGCGCGCCTGCCCATCCATTGAATTGCTCTGCATTACACCTG
                      ____________________________________________________________
consensus ACACTGTCAGCCAGGCTAGGCGCGCCTGCCCATCCATTGAATTGCTCTGCATTACACCTG
 
. : . : . : . : . : . :
JMFF049G14+ ATCGAAGATTTCGCTGCGGAGAGTTTGCGGTTCAGTATGCAACTTGCAGGTAATCGCAGA
                      ____________________________________________________________
consensus ATCGAAGATTTCGCTGCGGAGAGTTTGCGGTTCAGTATGCAACTTGCAGGTAATCGCAGA
 
. : . : . : . : . : . :
JMFF049G14+ GACGCCATTGATTCTGGAGTTTTCCTACAGAGAAGACTAGGTGTTTGGGGGTTTGTAGTA
                      ____________________________________________________________
consensus GACGCCATTGATTCTGGAGTTTTCCTACAGAGAAGACTAGGTGTTTGGGGGTTTGTAGTA