Previous Contig 002105:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF049E02Sequence645002105 (2)pir|D84531|D845316e-34probable salt-inducible protein [imported] - Arabidopsis thaliana>gb:AC006248_15609010892 (2)
JMSF026H14Sequence586002105 (2)pir|D84531|D845313e-24probable salt-inducible protein [imported] - Arabidopsis thaliana>gb:AC006248_15780010892 (2)gb:OSJN00035_16936568e-21Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0044K18, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF049E02+ AAATTGGAAAACAAACTCAATAATGCATTACAAGTCTCAATCTTGG
                      ____________________________________________________________
consensus AAATTGGAAAACAAACTCAATAATGCATTACAAGTCTCAATCTTGG
 
. : . : . : . : . : . :
JMSF026H14+ TCTATCATCAAGTAGAAGCACTTCAATGCCTCGTCGCATTTCTTCA
JMFF049E02+ GCAAAATCCTCTTCTCTATCATCAAGTAGAAGCACTTCAATGCCTCGTCGCATTTCTTCA
                      ____________________________________________________________
consensus GCAAAATCCTCTTCTCTATCATCAAGTAGAAGCACTTCAATGCCTCGTCGCATTTCTTCA
 
. : . : . : . : . : . :
JMSF026H14+ ATTCACAATGCACCCGCACTAGAAAATCCAGAGATATCGTGCTCTTTATCTCCAACTTCT
JMFF049E02+ ATTCACAATGCACCCGCACTAGAAAATCCAGAGATATCGTGCCCTTTATCTCCAACTTCT
                      ____________________________________________________________
consensus ATTCACAATGCACCCGCACTAGAAAATCCAGAGATATCGTGCTCTTTATCTCCAACTTCT
 
. : . : . : . : . : . :
JMSF026H14+ CTCGAGCACTCATTAACCCATCAAAAATCTCTCTGTGCGTCGCAGTGCGAGAGTTGACTA
JMFF049E02+ CTCGAGCACTCATTAACCCATCAAAAATCTCTCTTTGCGTTGCAGTGCGAGAGTTGACTA
                      ____________________________________________________________
consensus CTCGAGCACTCATTAACCCATCAAAAATCTCTCTTTGCGTTGCAGTGCGAGAGTTGACTA
 
. : . : . : . : . : . :
JMSF026H14+ CTTGCTNGAGTAGCTGTATTGCTTGATGTGGTGATGGAAGGCGAGAGAGTATTGAAATGG
JMFF049E02+ CTTGCTTGAGTAGCTGTATTGCTTGATGTGGTGATGGAAGGCGAGAGAGTATTGAAATGG
                      ____________________________________________________________
consensus CTTGCTTGAGTAGCTGTATTGCTTGATGTGGTGATGGAAGGCGAGAGAGTATTGAAATGG
 
. : . : . : . : . : . :
JMSF026H14+ CGATGCAGTAGCAGTCAATGTCGAGAGACTTGGGGCTGAGCTTTTGAATGAATTCGAGAA
JMFF049E02+ CGATGCAGTAGCAGTCAATGTCGAGAGACTTGGGGCTGAGCTTTTGAATGAATTCGAGAA
                      ____________________________________________________________
consensus CGATGCAGTAGCAGTCAATGTCGAGAGACTTGGGGCTGAGCTTTTGAATGAATTCGAGAA
 
. : . : . : . : . : . :
JMSF026H14+ CGTGNCCTGGGGATGAGCGGAGATTTGAGAGGNTGGAGGAGACCAAGGTGGGCGTAAGTT
JMFF049E02+ CGTGGCCTGGGGATGAGCGGAGATTTGAGAGGGTGGAGGAGACCAAGGTGGGCGTAAGTT
                      ____________________________________________________________
consensus CGTGGCCTGGGGATGAGCGGAGATTTGAGAGGGTGGAGGAGACCAAGGTGGGCGTAAGTT
 
. : . : . : . : . : . :
JMSF026H14+ CGGGCAAAACCTGTTTGATGAATTGCCACTGAGAAGAAATCACACAGTCCCNGAGAGCCT
JMFF049E02+ CGGGCAAAACCTGTTTGATGAATTGCCACTGAGAAGAAATCACACAGTCCCGGAGAGCCT
                      ____________________________________________________________
consensus CGGGCAAAACCTGTTTGATGAATTGCCACTGAGAAGAAATCACACAGTCCCGGAGAGCCT
 
. : . : . : . : . : . :
JMSF026H14+ CGCCTGTGATTGCAGGGGAGGTTGTGGGCTTCNCGGTTGTAACAAGATTACGTNATGAGA
JMFF049E02+ CGCCTGTGATTGCAGGGGAGGTTGTGGGCTTCGCGGTTGTAACAAGATTACGTGATGAGA
                      ____________________________________________________________
consensus CGCCTGTGATTGCAGGGGAGGTTGTGGGCTTCGCGGTTGTAACAAGATTACGTGATGAGA
 
. : . : . : . : . : . :
JMSF026H14+ AGTGCCTGATAACCTGTAAAAGNTTAGGCCTATCGAGCTTTCTGACTGGAATAGCTTGGC
JMFF049E02+ AGTGCCTGATAACCTGTAAAAGCTTAGGCCTATCGAGCTTTCTGACTGGAATAGCTTGGC
                      ____________________________________________________________
consensus AGTGCCTGATAACCTGTAAAAGCTTAGGCCTATCGAGCTTTCTGACTGGAATAGCTTGGC
 
. : . : . : . : . : . :
JMSF026H14+ GGATTCTCATCTTCCACGGCTCGAGGCGGAACGCGGGAGGTCTGCAATTTGTTGG
JMFF049E02+ GGATTCTCATCTTCCACGGCTCGAGGCGG-ACGCGGGAGGTCTGCAATTTGTTGGTTGCT
                      ____________________________________________________________
consensus GGATTCTCATCTTCCACGGCTCGAGGCGGAACGCGGGAGGTCTGCAATTTGTTGGTTGCT