Previous Contig 002103:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041C12Sequence623002103 (6)pir|B84420|B844203e-44transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A582002103 (6)pir|B84420|B844203e-12transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A
JMFF049C13Sequence512002103 (6)pir|B84420|B844205e-12transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A296010883 (2)
JMSF018L16Sequence506002103 (6)pir|B84420|B844204e-34transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A790002103 (6)pir|B84420|B844208e-34transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A
JMSF021L22Sequence667002103 (6)pir|B84420|B844202e-24transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A769010883 (2)pir|B84420|B844201e-20transfactor-like protein [imported] - Arabidopsis thaliana>gb:AC006837_1534623 A

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF041C12- CTTTTTTTTTTTTTTTTTAAAACA
                      ____________________________________________________________
consensus CTTTTTTTTTTTTTTTTTAAAACA
 
. : . : . : . : . : . :
rJMFF041C12- AGAGTTTAAACATACTGCATTTTAAACCAAGAGGTTTCAGTGGCCTAATAGAAATACATA
rJMSF018L16- AACATACTGCATTTTAAACCAAGAGGTTTCAGTGGCCTAATAGAAATACATA
                      ____________________________________________________________
consensus AGAGTTTAAACATACTGCATTTTAAACCAAGAGGTTTCAGTGGCCTAATAGAAATACATA
 
. : . : . : . : . : . :
rJMFF041C12- TGTTTTACAGGGATGAAGGTGTTACACAGCTACACTGCCATAGGGCATTAAATAACACTA
rJMSF018L16- TGTTTTACAGGGATGAAGGTGTTACACAGCTACACTGCCATAGGGCATTAAATAACACTA
                      ____________________________________________________________
consensus TGTTTTACAGGGATGAAGGTGTTACACAGCTACACTGCCATAGGGCATTAAATAACACTA
 
. : . : . : . : . : . :
rJMFF041C12- CATATTGCCACTGCAGATTTTCTCCCTCGGGTCTTCATTACCGATAGATAGTCCCGACGA
rJMSF018L16- CATATTGCCACTGCAGATTTTCTCCCTCGGGTCTTCATTACCGATAGATAGTCCCGACGA
                      ____________________________________________________________
consensus CATATTGCCACTGCAGATTTTCTCCCTCGGGTCTTCATTACCGATAGATAGTCCCGACGA
 
. : . : . : . : . : . :
rJMFF041C12- ATGGCTGAGATGCTCTCTTGTCAGGAAAACTGTATCTGGCTGCTGGTATGAGGGGGGGCT
rJMSF018L16- ATGGCTGAGATGCTCTCTTGTCAGGAAAACTGTATCTGGCTGCTGGTATGAGGGGGGGCT
                      ____________________________________________________________
consensus ATGGCTGAGATGCTCTCTTGTCAGGAAAACTGTATCTGGCTGCTGGTATGAGGGGGGGCT
 
. : . : . : . : . : . :
rJMFF041C12- CAAGCTTGATTCCAATATTGGATGAGTGAGCATCACATTGGGTTTGGCGAGTGCAGCGCC
rJMSF018L16- CAAGCTTGATTCCAATATTGGATGAGTGAGCATCACATTGGGTTTGGCGAGTGCAGCGCC
                      ____________________________________________________________
consensus CAAGCTTGATTCCAATATTGGATGAGTGAGCATCACATTGGGTTTGGCGAGTGCAGCGCC
 
. : . : . : . : . : . :
rJMFF041C12- CGAATCTAGCTTCTGCATTTTGGAAGGCCTCTCGCCTGTAGGGGATTCTATTTGAGAGGT
rJMSF018L16- CGAATCTAGCTTCTGCATTTTGGAAGGCCTCTCGCCTGTAGGGGATTCTATTTGAGAGGT
                      ____________________________________________________________
consensus CGAATCTAGCTTCTGCATTTTGGAAGGCCTCTCGCCTGTAGGGGATTCTATTTGAGAGGT
 
. : . : . : . : . : . :
rJMFF041C12- CTCGTGGCCACCAAAATCGGGGGTGAGAGGTTCGTGATGAGAAGAGAATGACTCATCGAG
rJMSF018L16- CTCGTGGCCACCAGAATCGGGGGTGAGAGGTTCGTGATGAGAAGAGAATGACTCATCGAG
                      ____________________________________________________________
consensus CTCGTGGCCACCAGAATCGGGGGTGAGAGGTTCGTGATGAGAAGAGAATGACTCATCGAG
 
. : . : . : . : . : . :
rJMFF041C12- GGAATGGCTCTTGGCTGGTGCACGCTCCTTTGCATGCTTGTCGCCGTGAGGAGACTCGGA
rJMSF018L16- GGAATGGCTCTTGGCTGGTGCACGCTCCTTTGCATGCTTGTCGCCGTGAGGAGACTCGGA
                      ____________________________________________________________
consensus GGAATGGCTCTTGGCTGGTGCACGCTCCTTTGCATGCTTGTCGCCGTGAGGAGACTCGGA
 
. : . : . : . : . : . :
rJMFF041C12- TGTAGGCGCGGGAGTTGATGGAGGATCAGTCGCATTGATAGATTCGGGGCCATGCTCACC
rJMSF018L16- TGTAGGCGCGGGAGTTGATGGAGGATCAGTCGCATTGATAGATTCGGGGCCATGCTCACC
                      ____________________________________________________________
consensus TGTAGGCGCGGGAGTTGATGGAGGATCAGTCGCATTGATAGATTCGGGGCCATGCTCACC
 
. : . : . : . : . : . :
rJMFF041C12- TGCCGCTGGATTCACCCC
rJMSF018L16- TGCCGCTGGATTCACCCCGCTTCCCGGGGCTTCCGTAAGCACCCCACTCAGTCGCTGTTG
                      ____________________________________________________________
consensus TGCCGCTGGATTCACCCCGCTTCCCGGGGCTTCCGTAAGCACCCCACTCAGTCGCTGTTG
 
. : . : . : . : . : . :
rJMSF018L16- TTCTTCGATTATCTTCTTCAAATACTTCCCTTGAGCTTCTATTCTCAGTTGTAGCTGGCG
                      ____________________________________________________________
consensus TTCTTCGATTATCTTCTTCAAATACTTCCCTTGAGCTTCTATTCTCAGTTGTAGCTGGCG
 
. : . : . : . : . : . :
rJMSF018L16- CTGAACCTCTAGTTGCTCATGTAGTCGCTTTTGCACCTCCATCTGCAGCTTTAATGCCTC
JMFF041C12+ ACCTCTAGTTGCTCATGTAGTCGCTTNTGCACCTCCATCTGCAGCTTTAATGCCTC
                      ____________________________________________________________
consensus CTGAACCTCTAGTTGCTCATGTAGTCGCTTTTGCACCTCCATCTGCAGCTTTAATGCCTC
 
. : . : . : . : . : . :
rJMSF018L16- AGTGATTTGCATTCCAGATGA
JMFF041C12+ AGTGATTTGCATTCCAGATGAGCCATCCAAATTTGAGATCATATCCCTCGACTCTTTCTT
                      ____________________________________________________________
consensus AGTGATTTGCATTCCAGATGAGCCATCCAAATTTGAGATCATATCCCTCGACTCTTTCTT
 
. : . : . : . : . : . :
JMFF041C12+ GTCAGCTTTTTTCCCATCGGAAGAGGAATCAGGAAGGTATTTGGCAAGTCGATATTTCTG
                      ____________________________________________________________
consensus GTCAGCTTTTTTCCCATCGGAAGAGGAATCAGGAAGGTATTTGGCAAGTCGATATTTCTG
 
. : . : . : . : . : . :
JMSF018L16+ AAATGGCTCTTTACGTGATAAATTGTAAGCCCTTGCACACCCATGACTCTCAAGACACC
JMFF041C12+ CAAATGGCTCTTTACGTGATAAATTGTAAGCCCTTGCACACCCATGACTCTCAAGACACC
JMSF021L22+ AAATGGCTTTTTACATGATAAATTGTCAGCCCTTGCACACCCATGAGTCTCAAAACACC
JMFF049C13+ CTCAAAACACC
                      ____________________________________________________________
consensus CAAATGGCTCTTTACGTGATAAATTGTAAGCCCTTGCACACCCATGACTCTCAAGACACC
 
. : . : . : . : . : . :
JMSF018L16+ TTTCGGTGTAGCCCGATCGGGGCCACCGAGTTGTGCCACTGCATCAAC-AAATCGCTCAT
JMFF041C12+ TTTCGGTGTAGCCCGATCGGGGCCACCGAGTTGTGCCACTGCATCAAC-AAATCGCTCAT
JMSF021L22+ TTTAGGAGTAGCCCTATCTGGGCCACCAAGTTGTGCAACTGAATCAAC-AAATCTTTCAT
JMFF049C13+ TTTAGGAGTAGCCCTATCTGGGGCACCAAGTTGTGCAACTGAATCAACAAAATCTTTCAT
                      ____________________________________________________________
consensus TTTCGGTGTAGCCCTATCTGGGCCACCGAGTTGTGCCACTGCATCAAC-AAATCTTTCAT
 
. : . : . : . : . : . :
JMSF018L16+ GAAGTTCATTTGTCCAACGGAGACGTTGTTTTGAAGCGAGACTTGGATTGTTGTTGAGGT
JMFF041C12+ GAAGTTCATTTGTCCAACGGAGACGTTGTTTTGAAGCGAGACTTGGATTGTTGTTGAGGT
JMSF021L22+ GAAGCTCATGTGACCAACGCAGACGTTGTTTTGAAGCAAGACTAGGATTGTTGTTGAGAT
JMFF049C13+ GAAGCTCATGTGACCAACGCAGACGTTGTTTTGAAGCAAGACTAGGATTGTTGTTGAGAT
                      ____________________________________________________________
consensus GAAGTTCATTTGTCCAACGGAGACGTTGTTTTGAAGCGAGACTTGGATTGTTGTTGAGGT
 
. : . : . : . : . : . :
JMSF018L16+ TATTACCCCCACTGATTGGATCCATTGTGCTGG
JMFF041C12+ TATTACCCCCACTGATTGGATCCATTGTGCTGG
JMSF021L22+ TGTTATCCCCATTGATTGGTTCCATTGTGCTGGCACTAAAGTCTAATGTCTGCTGGCTGA
JMFF049C13+ TGTTATCCCCATTGATTGGTTCCATTGTGCTGGCACTAAAGTCTAATGTCTGCTGGCTGA
                      ____________________________________________________________
consensus TGTTATCCCCATTGATTGGTTCCATTGTGCTGGCACTAAAGTCTAATGTCTGCTGGCTGA
 
. : . : . : . : . : . :
JMSF021L22+ CTATTGCCTTGTTGGGTACTAAGCTTGAACTAAGAACAGCTTTCGGTTGGTACATTACAT
JMFF049C13+ CTATTGCCTTGTTGGGTACTAAGCTTGAACTAAGAACAGCTTTCGGTTGGTACATTACAT
                      ____________________________________________________________
consensus CTATTGCCTTGTTGGGTACTAAGCTTGAACTAAGAACAGCTTTCGGTTGGTACATTACAT
 
. : . : . : . : . : . :
JMSF021L22+ TAAGCGCCCAAATAAGAGGTTGAACAGTGCTTCCTCTCCTCCTCCTCTGTCTTTGACGGC
JMFF049C13+ TAAGCGCCCAAATAAGAGGTTGAACAGTGCTTCCTCTCCTCCTCCTCTGTCTTTGA-GGC
                      ____________________________________________________________
consensus TAAGCGCCCAAATAAGAGGTTGAACAGTGCTTCCTCTCCTCCTCCTCTGTCTTTGACGGC
 
. : . : . : . : . : . :
JMSF021L22+ GATCTCCGATCCTTCTCTCTCTGTGCTTTGACTTATAGAGAAAGGACGTAGACAAAGATG
JMFF049C13+ GATCTCCGATCCTTCTCTCTCTGTGCTTTGACTTATAGAGAAAGGACGTAGACAAAGATG
                      ____________________________________________________________
consensus GATCTCCGATCCTTCTCTCTCTGTGCTTTGACTTATAGAGAAAGGACGTAGACAAAGATG
 
. : . : . : . : . : . :
JMSF021L22+ AAAGTCGGAGATATGAATTTAAAATCCGCGGCGATTACGTAAGGCGGCTGCCGAAGCTGA
JMFF049C13+ AAAGTCGGAGATATGAATTTAAAATCCGCGGCGATTACGTAAGGCGGCTGCCGAAGCTGA
                      ____________________________________________________________
consensus AAAGTCGGAGATATGAATTTAAAATCCGCGGCGATTACGTAAGGCGGCTGCCGAAGCTGA
 
. : . : . : . : . : . :
JMSF021L22+ GGTGAGGCGGAGTAGGAAGAGATCAGAGATGAGATGATTGTTCAGCCGGCG
JMFF049C13+ GGTGAGGCGGAGTAGGAAGAGATCAGAGATGAGATGATTGTTCAGCCGGCGGTTCACAAT
                      ____________________________________________________________
consensus GGTGAGGCGGAGTAGGAAGAGATCAGAGATGAGATGATTGTTCAGCCGGCGGTTCACAAT