Previous Contig 002098:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002A15Sequence441002098 (27)pir|G96669|G966693e-38protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi728010641 (24)pir|G96669|G966692e-41protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF002E13Sequence516002098 (27)pir|G96669|G966691e-46protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF006I11Sequence593002098 (27)pir|G96669|G966692e-61protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi759010641 (24)pir|G96669|G966691e-46protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF018E02Sequence592002098 (27)pir|G96669|G966691e-55protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi620010641 (24)pir|G96669|G966695e-26protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF019G01Sequence583002098 (27)pir|G96669|G966692e-59protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi739010641 (24)gb:AB040741_15196395e-73Oryza sativa RRJ1 mRNA, patial cds.
JMFF023C21Sequence569002098 (27)pir|G96669|G966691e-55protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi730010641 (24)pir|G96669|G966697e-40protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF024N02Sequence590002098 (27)pir|G96669|G966691e-62protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi746010641 (24)pir|G96669|G966694e-42protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF025B18Sequence586002098 (27)pir|G96669|G966693e-60protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi778010641 (24)pir|G96669|G966693e-72protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF025N01Sequence591002098 (27)pir|G96669|G966692e-61protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi672010641 (24)pir|G96669|G966691e-34protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF027C20Sequence520002098 (27)pir|G96669|G966692e-48protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi724010641 (24)pir|G96669|G966696e-46protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF027J05Sequence407002098 (27)pir|G96669|G966699e-32protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi413010641 (24)gb:AB040741_15196393e-04Oryza sativa RRJ1 mRNA, patial cds.
JMFF030M09Sequence449002098 (27)pir|G96669|G966696e-38protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi672010641 (24)pir|G96669|G966693e-35protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF032C01Sequence492002098 (27)pir|G96669|G966694e-44protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi684010641 (24)pir|G96669|G966692e-34protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF034K21Sequence594002098 (27)pir|G96669|G966697e-47protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi734010641 (24)gb:AB040741_15196397e-75Oryza sativa RRJ1 mRNA, patial cds.
JMFF039N14Sequence405002098 (27)pir|G96669|G966692e-25protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi747010641 (24)pir|G96669|G966694e-66protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF045C06Sequence651002098 (27)pir|G96669|G966694e-66protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi635010641 (24)pir|G96669|G966699e-43protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF046G07Sequence607002098 (27)pir|G96669|G966698e-59protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi575010641 (24)gb:AB040741_15196396e-15Oryza sativa RRJ1 mRNA, patial cds.
JMFF049A03Sequence458002098 (27)gb:AE016959_10234492e-19Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence.>gb:AC02521010641 (24)pir|G96669|G966694e-34protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFF049J05Sequence601002098 (27)pir|G96669|G966691e-62protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi612010641 (24)pir|G96669|G966692e-40protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFS041E05Sequence621002098 (27)pir|G96669|G966691e-74protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFS095H05Sequence612002098 (27)pir|G96669|G966699e-66protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMFS143D11Sequence627002098 (27)pir|G96669|G966694e-67protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF032E21Sequence630002098 (27)pir|G96669|G966699e-64protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi702010641 (24)pir|G96669|G966695e-40protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF041K17Sequence786002098 (27)pir|G96669|G966691e-90protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi732010641 (24)pir|G96669|G966695e-38protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF042K17Sequence412002098 (27)pir|G96669|G966697e-60protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi758011816 (36)gb:ATAC002343_15427849e-33Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete sequence
JMSF044D17Sequence663002098 (27)pir|G96669|G966695e-70protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi751010641 (24)pir|G96669|G966699e-83protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi
JMSF045D17Sequence102002098 (27)733010641 (24)pir|G96669|G966697e-74protein F1N19.23 [imported] - Arabidopsis thaliana>gb:AE005173_894120 Arabidopsi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041K17+ CCAATTTGGCC
                      ____________________________________________________________
consensus CCAATTTGGCC
 
. : . : . : . : . : . :
JMSF042K17+ CTTGTCGTGG
JMSF041K17+ GGCGACAGGACCATCGGAGAGAAGGTGTTGTCGACGACCACCATGGCTCCCTTGTCGTGG
                      ____________________________________________________________
consensus GGCGACAGGACCATCGGAGAGAAGGTGTTGTCGACGACCACCATGGCTCCCTTGTCGTGG
 
. : . : . : . : . : . :
JMSF044D17+ CGACGCTTTCG
JMFF045C06+ G
JMFS041E05+ GCGACGGTGAGGGTTGGATTGGCGACGCTTTCG
JMSF042K17+ GCTATCCGGGAGAGCTCCGGGATGTTAGCGACGGTGAGGGTTGGATTGGCGACGCTTTCG
JMSF041K17+ GCTATCCGGGAGAGCTCCGGGATGTTAGCGACGGTGAGGGTTGGATTGGCGACGCTTTCG
                      ____________________________________________________________
consensus GCTATCCGGGAGAGCTCCGGGATGTTAGCGACGGTGAGGGTTGGATTGGCGACGCTTTCG
 
. : . : . : . : . : . :
JMSF044D17+ AAGTAGAGGACCTTGGTCTTTCCCTCAACGANGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMFF045C06+ AAGTAGAGGACC-TGGTCTTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMFS095H05+ TTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMFS143D11+ GGACCTTGGTCTTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMSF032E21+ TCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMFS041E05+ AAGTAGAGGACCTTGGTCTTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMFF024N02+ GGTCCCGG
JMFF049J05+ GAGGTCCCGG
JMFF034K21+ G
JMFF046G07+ CGAGGTCCCGG
JMSF042K17+ AAGTAGAGGACCTTGGTCTTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
JMSF041K17+ AAGTAGAGGACCTTGGTCTTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
                      ____________________________________________________________
consensus AAGTAGAGGACCTTGGTCTTTCCCTCAACGATGGCGTCTTTCACGGCGGCGAGGTCCCGG
 
. : . : . : . : . : . :
JMSF044D17+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF045C06+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFS095H05+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFS143D11+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMSF032E21+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFS041E05+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF024N02+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF049J05+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF018E02+ TCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF019G01+ GAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF023C21+ GGGGGAGGAAATGGGTGAGCAGGGCG
JMFF006I11+ TGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF025N01+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF025B18+ GACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF034K21+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMFF046G07+ ATGTCGACGAAGGTGGTGGTGATGTGNCAGACGTGGGGGAGGAAATGGGTGAGCAGGGCG
JMSF042K17+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
JMSF041K17+ ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
                      ____________________________________________________________
consensus ATGTCGACGAAGGTGGTGGTGATGTTGCAGACGCGGGGGAGGAAATGGGTGAGCAGGGCG
 
. : . : . : . : . : . :
JMSF044D17+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF045C06+ TGGGTGCCGCCGTAGAGGGCACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFS095H05+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFS143D11+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMSF032E21+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFS041E05+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF024N02+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF049J05+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF018E02+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF019G01+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF023C21+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF027C20+ GTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF032C01+ ATCGCCGGAGCTGAGGAGCTGG
JMFF002E13+ GTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF006I11+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF025N01+ TGGGTGCCNCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF025B18+ TGGGTGCCGCCGTAGAGGGCACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF034K21+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMFF046G07+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMSF042K17+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
JMSF041K17+ TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
                      ____________________________________________________________
consensus TGGGTGCCGCCGTAGAGGGTACGCGCCGCCACCACGTGATCGCCGGAGCTGAGGAGCTGG
 
. : . : . : . : . : . :
JMSF044D17+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF045C06+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFS095H05+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFS143D11+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMSF032E21+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFS041E05+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF024N02+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF049J05+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF018E02+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF019G01+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF023C21+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF027C20+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF032C01+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF030M09+ ACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF027J05+ TGCC
JMFF002A15+ GACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF002E13+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF006I11+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF025N01+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF025B18+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF034K21+ AACATGACCGACGAGATCCGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMFF046G07+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMSF042K17+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
JMSF041K17+ AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
                      ____________________________________________________________
consensus AACATGACCGACGAGAT-CGCCGACATGCCGGAGGCGGTACAGTAGGCCGCCTCGGTGCC
 
. : . : . : . : . : . :
JMSF044D17+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF045C06+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFS095H05+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFS143D11+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMSF032E21+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFS041E05+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF024N02+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF049J05+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF018E02+ TTCCATGGCGGGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF019G01+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF023C21+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF027C20+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF032C01+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF030M09+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF027J05+ TTCCATGGC-GNCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF002A15+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF039N14+ GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF002E13+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF006I11+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF025N01+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF025B18+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF034K21+ TTCCATGGCGGGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMFF046G07+ TTCCATGGC-GGCCATGAGGCGGCTGAGTTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMSF042K17+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
JMSF041K17+ TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
                      ____________________________________________________________
consensus TTCCATGGC-GGCCATGAGGCGGCTGACGTTGAGGACGGTGGGGTTGAAGTGGCGGCTGT
 
. : . : . : . : . : . :
JMSF044D17+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF045C06+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFS095H05+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFS143D11+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMSF032E21+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFS041E05+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF024N02+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF049J05+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF018E02+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF019G01+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF023C21+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF027C20+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF032C01+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF030M09+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTTC-
JMFF027J05+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF002A15+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF039N14+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCCC
JMFF002E13+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF006I11+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF025N01+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF025B18+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF034K21+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF046G07+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMSF042K17+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATT
JMSF041K17+ AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
JMFF049A03+ ATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
                      ____________________________________________________________
consensus AGATGAAGTAATCGTTATCGGGTCCCAGCTCCCCGGAGAACATTCGCCGCAGCGACTCC-
 
. : . : . : . : . : . :
JMSF044D17+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF045C06+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFS095H05+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFS143D11+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMSF032E21+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFS041E05+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF024N02+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF049J05+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF018E02+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF019G01+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTA
JMFF023C21+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF027C20+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF032C01+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF030M09+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF027J05+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF002A15+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF039N14+ GGGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF002E13+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF006I11+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF025N01+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF025B18+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF034K21+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTA
JMFF046G07+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMSF041K17+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
JMFF049A03+ -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
                      ____________________________________________________________
consensus -GGCTCCATGACCGTGAAGGTGGCGGAGGCCTCGATGGACATGTTGACGCCGCCGTGCTC
 
. : . : . : . : . : . :
JMSF044D17+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF045C06+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFS095H05+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFS143D11+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMSF032E21+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFS041E05+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF024N02+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF049J05+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF018E02+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF019G01+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF023C21+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF027C20+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF032C01+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF030M09+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF027J05+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF002A15+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF039N14+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF002E13+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF006I11+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF025N01+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF025B18+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF034K21+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF046G07+ GCCGAACTCGTGGCGGGCGCGGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMSF041K17+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
JMFF049A03+ GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
                      ____________________________________________________________
consensus GCCGAACTCGTGGCGGGCGCTGGCCAACGCCGCCGCCGGGTCCTCCCACATCTGCACCGC
 
. : . : . : . : . : . :
JMSF044D17+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF045C06+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFS095H05+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFS143D11+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMSF032E21+ CGGCTTGCCGCCCTTCTTCGCCTT-ATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFS041E05+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF024N02+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF049J05+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF018E02+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF019G01+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF023C21+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF027C20+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF032C01+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF030M09+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF027J05+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF002A15+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF039N14+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF002E13+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF006I11+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF025N01+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF025B18+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF034K21+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF046G07+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATTGTCGCGCTCCCATTCGCTCGGAACCCG
JMSF041K17+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
JMFF049A03+ CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
                      ____________________________________________________________
consensus CGGCTTGCCGCCCTTCTTCGCCTTCATCATATCGTCGCGCTCCCATTC-CTCGGAACCCG
 
. : . : . : . : . : . :
JMSF044D17+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF045C06+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFS095H05+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFS143D11+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMSF032E21+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFS041E05+ GCCTCCTTTTGTTTGAAACGTTGACGTTTNNTGATGGATGGTCTCCGCCATTG
JMFF024N02+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF049J05+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF018E02+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF019G01+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF023C21+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF027C20+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF032C01+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF030M09+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF027J05+ GCCTCCTTTTGTTTGAAACGTTGACGTTN--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF002A15+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF039N14+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMSF045D17+ AAACGTTGANGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF002E13+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF006I11+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF025N01+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF025B18+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF034K21+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF046G07+ GCCTCCTTTTGTTTGAAATGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMSF041K17+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
JMFF049A03+ GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
                      ____________________________________________________________
consensus GCCTCCTTTTGTTTGAAACGTTGACGTTT--TGATGGATGGTCTCCGCCATTGTTGCACA
 
. : . : . : . : . : . :
JMSF044D17+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFF045C06+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFS095H05+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGA
JMFS143D11+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAG
JMSF032E21+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFF024N02+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGAT
JMFF049J05+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGA
JMFF018E02+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
JMFF019G01+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGAT
JMFF023C21+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
JMFF027C20+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGAT
JMFF032C01+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGA
JMFF030M09+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFF027J05+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGAT
JMFF002A15+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGAT
JMFF039N14+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMSF045D17+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFF002E13+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
JMFF006I11+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
JMFF025N01+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFF025B18+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGAC
JMFF034K21+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGAT
JMFF046G07+ GAAATCGCAGTGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
JMSF041K17+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
JMFF049A03+ GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
                      ____________________________________________________________
consensus GAAATCGCA-AGAAATTAGAGAGATCAGTTTTGTCGGAGAAGATAATGATGAGATTGACA
 
. : . : . : . : . : . :
JMFF018E02+ GT
JMFF023C21+ GT
JMFF006I11+ GT
JMFF046G07+ GT
JMSF041K17+ GT
JMFF049A03+ GTGTTAGTTAATGCGATCGAGTGTGTATATATAGTACCCCGCTGCCACAAAGTAATCGTA
                      ____________________________________________________________
consensus GTGTTAGTTAATGCGATCGAGTGTGTATATATAGTACCCCGCTGCCACAAAGTAATCGTA
 
. : . : . : . : . : . :
JMFF049A03+ ACGGAAGAAAATTAGATAAATACAATTGCCATAAATTGAGTGACGTGGCGTCCACATACC
                      ____________________________________________________________
consensus ACGGAAGAAAATTAGATAAATACAATTGCCATAAATTGAGTGACGTGGCGTCCACATACC