Previous Contig 002091:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048O01Sequence373002091 (2)gb:AY085669_15707364e-47Arabidopsis thaliana clone 16846 mRNA, complete sequence.555010855 (2)gb:AF428329_17992594e-52Arabidopsis thaliana AT3g23810/MYM9_15 mRNA, complete cds.
JMSF046M12Sequence723002091 (2)sp|P35007|SAHH_CATROe-104Adenosylhomocysteinase (EC 3.3.1.1) (S-adenosyl-L-homocysteine hydrolase) (AdoHc674010855 (2)gb:AF428329_17992594e-83Arabidopsis thaliana AT3g23810/MYM9_15 mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF046M12+ CTG
                      ____________________________________________________________
consensus CTG
 
. : . : . : . : . : . :
JMSF046M12+ GTAAAGCCTCTTGACACCAGTGGTAGTCTCCTCAGAAACCCCAACAAGCCTTTGCTTCAT
                      ____________________________________________________________
consensus GTAAAGCCTCTTGACACCAGTGGTAGTCTCCTCAGAAACCCCAACAAGCCTTTGCTTCAT
 
. : . : . : . : . : . :
JMSF046M12+ CTTAGTATACCTCTGGGGATCACTCTTAAGCCCATCCCTAATGATGGTCAACACAATCTT
                      ____________________________________________________________
consensus CTTAGTATACCTCTGGGGATCACTCTTAAGCCCATCCCTAATGATGGTCAACACAATCTT
 
. : . : . : . : . : . :
JMSF046M12+ AAACTCCGCATTATCAGTCGAACTCGGATCAGGGAGAGCCCCATTCTTAGCAAACGCCTC
                      ____________________________________________________________
consensus AAACTCCGCATTATCAGTCGAACTCGGATCAGGGAGAGCCCCATTCTTAGCAAACGCCTC
 
. : . : . : . : . : . :
JMSF046M12+ CTCAGCCTTCACCCCCTCATGGATCAACAACGTAGCATCCCCGCCATCATCCACAATGAG
                      ____________________________________________________________
consensus CTCAGCCTTCACCCCCTCATGGATCAACAACGTAGCATCCCCGCCATCATCCACAATGAG
 
. : . : . : . : . : . :
JMSF046M12+ ATCCGGGCCGCCACCGGCCCCCCAGTCCAGCGCCCTCTCCGTGCACCACCAGTACTCCTG
                      ____________________________________________________________
consensus ATCCGGGCCGCCACCGGCCCCCCAGTCCAGCGCCCTCTCCGTGCACCACCAGTACTCCTG
 
. : . : . : . : . : . :
JMSF046M12+ GAGGGTCTCCCCCTTCCAGGCGAACACGGCGGCGCTGTCGCGCGCAACGGCCGCCGCGGC
JMFF048O01+ GCGGC
                      ____________________________________________________________
consensus GAGGGTCTCCCCCTTCCAGGCGAACACGGCGGCGCTGTCGCGCGCAACGGCCGCCGCGGC
 
. : . : . : . : . : . :
JMSF046M12+ GTGGTCCTGCGTGGAGAAGATGTTGCAGGAGCACCATCTCACCTCCGCGCCCAACGCCGT
JMFF048O01+ GTGGTCCTGCGTGGAGAAGATGTTGCAGGAGCACCATCTCACCTCCGCGCCCAACGCCGT
                      ____________________________________________________________
consensus GTGGTCCTGCGTGGAGAAGATGTTGCAGGAGCACCATCTCACCTCCGCGCCCAACGCCGT
 
. : . : . : . : . : . :
JMSF046M12+ GAGGGTCTCGATCAGAACCGCCGTTTGGATCGTCATATGCAGACTGCCGGTAATCCTGGC
JMFF048O01+ GAGGGTCTCGATCAGAACCGCCGTTTGGATCGTCATATGCAGACTGCCGGTAATCCTGGC
                      ____________________________________________________________
consensus GAGGGTCTCGATCAGAACCGCCGTTTGGATCGTCATATGCAGACTGCCGGTAATCCTGGC
 
. : . : . : . : . : . :
JMSF046M12+ GCCCTTGAACGGCTGCGACGGCCCGAATTCGGTCCGGCAGGCCATCAGCCCCGGCATTTC
JMFF048O01+ GCCCTTGAACGGCTGCGACGGCCCGAATTCGGTCCGGCAGGCCATCAGCCCCGGCATTTC
                      ____________________________________________________________
consensus GCCCTTGAACGGCTGCGACGGCCCGAATTCGGTCCGGCAGGCCATCAGCCCCGGCATTTC
 
. : . : . : . : . : . :
JMSF046M12+ AACCTCGGCGAGATCGAGTTCGAGGCGGCCGAAATCAGCCAGAGACATGTCCTTCACCTT
JMFF048O01+ AACCTCGGCGAGATCGAGTTCGAGGCGGCCGAAATCAGCCAGAGACACGTCCTTCACCTC
                      ____________________________________________________________
consensus AACCTCGGCGAGATCGAGTTCGAGGCGGCCGAAATCAGCCAGAGACATGTCCTTCACCTT
 
. : . : . : . : . : . :
JMSF046M12+ GTACTCGCGGCCGGAGCTGGTTTTCTCGACGGTCAAAGCCAT
JMFF048O01+ GTACTCGCGGCCGGAGCTGGTTTTCTCGACGGTCAAAGCCATTGATATATCTCAGAGTTT
                      ____________________________________________________________
consensus GTACTCGCGGCCGGAGCTGGTTTTCTCGACGGTCAAAGCCATTGATATATCTCAGAGTTT
 
. : . : . : . : . : . :
JMFF048O01+ TTAGCTTCCTTCTATGGGGTTTAGGTTTTGGAACTAGCTTTAGAAGAAGAGAGTAGTACA
                      ____________________________________________________________
consensus TTAGCTTCCTTCTATGGGGTTTAGGTTTTGGAACTAGCTTTAGAAGAAGAGAGTAGTACA