Previous Contig 002086:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038H11Sequence566002086 (8)gb:LCO580824_16840353e-49Lotus corniculatus var. japonicus har1 gene and genes for transcription factor h702002086 (8)gb:LCO580824_16840351e-56Lotus corniculatus var. japonicus har1 gene and genes for transcription factor h
JMFF048N06Sequence442002086 (8)gb:LCO580824_16840356e-41Lotus corniculatus var. japonicus har1 gene and genes for transcription factor h272002086 (8)gb:AY057667_15640806e-06Arabidopsis thaliana At1g17880/F2H15_10 mRNA, complete cds.
JMFF048N14Sequence512002086 (8)gb:LCO580824_16840353e-48Lotus corniculatus var. japonicus har1 gene and genes for transcription factor h433002086 (8)gb:AY057667_15640802e-29Arabidopsis thaliana At1g17880/F2H15_10 mRNA, complete cds.
JMFN029L02Sequence633002086 (8)gb:LCO580824_16840353e-55Lotus corniculatus var. japonicus har1 gene and genes for transcription factor h
JMFN033F22Sequence504002086 (8)gb:LCO580824_16840353e-49Lotus corniculatus var. japonicus har1 gene and genes for transcription factor h

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048N14- AGGGTAAAATTAATTGAT
                      ____________________________________________________________
consensus AGGGTAAAATTAATTGAT
 
. : . : . : . : . : . :
rJMFF048N14- AACAATAACATCCATGTAATAAAGCTTGGAATCTCATAATACACATCATATTCAGCACTC
                      ____________________________________________________________
consensus AACAATAACATCCATGTAATAAAGCTTGGAATCTCATAATACACATCATATTCAGCACTC
 
. : . : . : . : . : . :
rJMFF048N06- GATAGCAAAGATCACAAATCACATAAAAGGAACAAAATTTAATTGAAATTTTA
rJMFF048N14- ACCCATAGATAGCAAAGATCACAAATCACATAAAAGGAACAAAATTTAATTGAAATTTTA
rJMFF038H11- GATAGGAAAGATCTCAAATCACTTAAAA-GAACAAAATTTAATTAAAATTTTA
                      ____________________________________________________________
consensus ACCCATAGATAGCAAAGATCACAAATCACATAAAAGGAACAAAATTTAATTGAAATTTTA
 
. : . : . : . : . : . :
rJMFF048N06- TTTTTGTCCCTCATCGGCAGCAGCTTCAAAGGTTTCACCATCCACAAGTTGGGGCACCTC
rJMFF048N14- TTTTTGTCCCTCATCGGCAGCAGCTTCAAAGGTTTCACCATCCACAAGTTGGGGCACCTC
JMFN029L02+ CATCGGCAGCAGCTTCAAAGGTTTCACCATCCACAAGTTGGGGCACCTC
rJMFF038H11- TTTTTGTCCCTCATCGGCAGCAGCTTCAAAGGTTTCACCATCCACGAGTTGGGGCACC--
                      ____________________________________________________________
consensus TTTTTGTCCCTCATCGGCAGCAGCTTCAAAGGTTTCACCATCCACAAGTTGGGGCACCTC
 
. : . : . : . : . : . :
rJMFF048N06- ATCATCATCATCTTCTTGAAGGGCATTTGCACCAGTAAATGCATCTGCACTATCAGCAGA
rJMFF048N14- ATCATCATCATCTTCTTGAAGGGCATTTGCACCAGTAGATGCATCTGCACTATCAGCAGT
JMFN033F22+ ATCATCATCTTCTTGCGGGGCATTTGCACCAGCAATTAAATCTGCACTATCAGCTGT
JMFF038H11+ ATCTGCACTATCAGCTGT
JMFN029L02+ ATCATCATCATCTTCTTGAAGGGCATTGCACCCAGTAGATGCATCTGCACTATCAGCAGT
rJMFF038H11- -TCATCATCATCTTCTTGCGGGGCATTTGCACCAGCAATTAAATCTGCACTATCAGCTGT
JMFF048N14+ GCACCAGTAGATGCATCTGCACTATCAGCAGT
                      ____________________________________________________________
consensus ATCATCATCATCTTCTTGAAGGGCATTTGCACCAGTAGATGCATCTGCACTATCAGCAGT
 
. : . : . : . : . : . :
rJMFF048N06- ACCAGTTGTTTGCTTTTGGAACTGCTCTGCCA
rJMFF048N14- ACCAGTTGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCAAGATTGTCAGG
JMFN033F22+ ACCAGTCGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCGAGATTGTCAGG
JMFF038H11+ ACCAGTCGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCGAGATTGTCAGG
JMFN029L02+ ACCAGTTGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCAAGATTGTCAGG
rJMFF038H11- ACCAGTCGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCGAGATTGTCAGG
JMFF048N06+ CAAGATTGTCAGG
JMFF048N14+ ACCAGTTGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCAAGATTGTCAGG
                      ____________________________________________________________
consensus ACCAGTTGTTTGCTTTTGGAACTGCTCTGCCAACTTCTTCAAGTTCTCAAGATTGTCAGG
 
. : . : . : . : . : . :
rJMFF048N14- ACCCAATTGGTGAATAATTTGAGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGAACC
JMFN033F22+ ACCCAATTGGTGAATAATTTGTGGAAGAATATCTTGCAATTTCTTAATGTGAGGAGCACC
JMFF038H11+ ACCCAATTGGTGAATAATTTGTGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGCACC
JMFN029L02+ ACCCAATTGGTGAATAATTTGAGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGAACC
rJMFF038H11- ACCCAATTGGTGAATAATTTGTGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGCACC
JMFF048N06+ ACCCAATTGGTGAATAATTTGAGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGAACC
JMFF048N14+ ACCCAATTGGTGAATAATTTGAGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGAACC
                      ____________________________________________________________
consensus ACCCAATTGGTGAATAATTTGAGGAAGAATATCTTGCAATTTCTTAATCTGAGGAGAACC
 
. : . : . : . : . : . :
rJMFF048N14- ACTCACAACCCAAGTATTTGCAGCAATTGAAGCTTGAACTTTTGGATTAAGGAAC
JMFN033F22+ ACTCACAACCCAAGTATTTGCGGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
JMFF038H11+ ACTCACAACCCAAGTATTTGCGGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
JMFN029L02+ ACTCACAACCCAAGTATTTGCAGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
rJMFF038H11- ACTCACAACCCAAGTATTTGCGGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
JMFF048N06+ ACTCACAACCCAAGTATTTGCAGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
JMFF048N14+ ACTCACAACCCAAGTATTTGCAGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
                      ____________________________________________________________
consensus ACTCACAACCCAAGTATTTGCAGCAATTGAAGCTTGAACTTTTGGATTAAGGAACTGGAC
 
. : . : . : . : . : . :
JMFN033F22+ AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
JMFF038H11+ AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
JMFN029L02+ AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
rJMFF038H11- AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
JMFF048N06+ AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
JMFF048N14+ AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
                      ____________________________________________________________
consensus AACTACATCCTCCTTAAAAATGTTCACCTCTTCTATGGCAGGAATGGCATTCACCCCTAT
 
. : . : . : . : . : . :
JMFN033F22+ TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCTGTAGTAGTAGTTTTGTGAACCGCCTT
JMFF038H11+ TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCTGTAGTAGTAGTTTTGTGAACCGCCTT
JMFN029L02+ TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCCGTGGTAGTAGTTTTGTGAACCGCCTT
rJMFF038H11- TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCTGTAGTAGTAGTTTTGTGAACCGCCTT
JMFF048N06+ TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCCGTGGTAGTAGTTTTGTGAACCGCCTT
JMFF048N14+ TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCCGTGGTAGTAGTTTTGTGAACCGCCTT
                      ____________________________________________________________
consensus TCTCTTCAGAGTACTCTGAAGTCTTTTGTCATCTGTAGTAGTAGTTTTGTGAACCGCCTT
 
. : . : . : . : . : . :
JMFN033F22+ CTTCTTTCTCCTCATAGTTCCCTTGCCACCGGTCCGGACAGAACCAGCCATCTTTTGAAG
JMFF038H11+ CTTCTTTCTCCTCATAGTTCCCTTGCCACCGGTCCGGACAGAACCAGCCATCTTTTGAAG
JMFN029L02+ CTTCTTTCTCCTCATAGTTCCCTTGCCACCAGTCCGGACAGAACCGGCCATCTTTTGAAG
rJMFF038H11- CTTCTTTCTCCTCATAGTTCCCTTGCCACCGGTCCGGACAGAACCAGCCATCTTTTGAAG
JMFF048N06+ CTTCTTTCTCCTCATAGTTCCCTTGCCACCAGTCCGGACAGAACCGGCCATCTTTTGAAG
JMFF048N14+ CTTCTTTCTCCTCATAGTTCCCTTGCCACCAGTCCGGACAGAACCGGCCATCTTTTGAAG
                      ____________________________________________________________
consensus CTTCTTTCTCCTCATAGTTCCCTTGCCACCGGTCCGGACAGAACCAGCCATCTTTTGAAG
 
. : . : . : . : . : . :
JMFN033F22+ CTTTTCTACATTCATCTCTGACGATGCTT
JMFF038H11+ CTTTTCTACATTCATCTC
JMFN029L02+ CTTTTCTACATTCATCTCG
rJMFF038H11- CTTTTCTACATTCATCTCTGACGATGCTT
JMFF048N06+ CTTTTCTACATTCATCTCG
JMFF048N14+ CTTTTCTACATTCATCTCGCACGATGCTTTAGCGGCTGTTGACCGAGGGCGGGAAATAGT
                      ____________________________________________________________
consensus CTTTTCTACATTCATCTCTGACGATGCTTTAGCGGCTGTTGACCGAGGGCGGGAAATAGT
 
. : . : . : . : . : . :
JMFF048N14+ GGCGGACGGTGGCGAGGGAGAGAGAGCGAGAGCTAGAGCTGTGATAGTTGGGATAAAAGT
                      ____________________________________________________________
consensus GGCGGACGGTGGCGAGGGAGAGAGAGCGAGAGCTAGAGCTGTGATAGTTGGGATAAAAGT