Previous Contig 002084:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028A03Sequence463002084 (3)gb:AY423549_16054762e-28Lycopersicon esculentum coronatine-insensitive 1 (Coi1) gene, complete cds.>gb:A
JMFF048M13Sequence397002084 (3)gb:AY423549_16054761e-18Lycopersicon esculentum coronatine-insensitive 1 (Coi1) gene, complete cds.>gb:A522021845gb:AY428737_16058247e-17Nicotiana tabacum coronatine-insensitive 1 (COI1) mRNA, partial cds.
JMSF004N21Sequence250002084 (3)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF028A03+ CCTGAGCGACTCCAGGAGAGAGAAGCGGCGGGCGAGCTGATCCGGGGAG
                      ____________________________________________________________
consensus CCTGAGCGACTCCAGGAGAGAGAAGCGGCGGGCGAGCTGATCCGGGGAG
 
. : . : . : . : . : . :
JMFF028A03+ GCGGTGTAGCAGAGGGCCATGGTCACGTGCTTCCGCGTGATGGCGTCGATCTCGAACCAC
JMFF048M13+ CACGTGCTTCCGCGTGATGGCGTCGATCTCGAACCAC
                      ____________________________________________________________
consensus GCGGTGTAGCAGAGGGCCATGGTCACGTGCTTCCGCGTGATGGCGTCGATCTCGAACCAC
 
. : . : . : . : . : . :
JMFF028A03+ CTCTTGCACACCATNGACACCGCATCCCGGTCCCGCGATTCNTGGATGTAGGGTATCACG
JMFF048M13+ CTCTTGCACACCATNGACACCGCATCCCGGTCCCGCGATTCCTGGATGTAGGGTATCACG
                      ____________________________________________________________
consensus CTCTTGCACACCATNGACACCGCATCCCGGTCCCGCGATTCCTGGATGTAGGGTATCACG
 
. : . : . : . : . : . :
JMFF028A03+ CACTCCCATACGGTGTCGTACGTGCTGCTCAGCCGTGTCCCACTCCTCTCCTCCATACTC
JMSF004N21+ TCCTCCATACTC
JMFF048M13+ CACTCCCATACGGTGTCGTACGTGCTGCTCAGCCGTGTCCCACTCCTCTCCTCCATACTC
                      ____________________________________________________________
consensus CACTCCCATACGGTGTCGTACGTGCTGCTCAGCCGTGTCCCACTCCTCTCCTCCATACTC
 
. : . : . : . : . : . :
JMFF028A03+ AACGCCCAACAATATATATATATAATTCCCTCCGAGAAACCACAAAACACCATCAAAACT
JMSF004N21+ AACGCCCAACAATATATATATATAATTCCCTCCGAGAAACCACAAAACACCATCAAAACT
JMFF048M13+ AACGCCCAACAATATATATATATAATTCCCTCCGAGAAACCACAAAACACCATCAAAACT
                      ____________________________________________________________
consensus AACGCCCAACAATATATATATATAATTCCCTCCGAGAAACCACAAAACACCATCAAAACT
 
. : . : . : . : . : . :
JMFF028A03+ CCATCCGCGACCTCGAACACTATCCTCCCTGCCTCGCCATGGNTACGGCTCCAGAAAACG
JMSF004N21+ CCATCCGCGACCTCGAACACTATCNTCCCTGCCTCGCCATGGNTACGGCTCCAGAAAACG
JMFF048M13+ CCATCCGCGACCTCGAACACTATCCTCCCTGCCTCGCCATGGCTACGGCTCCAGAAAACG
                      ____________________________________________________________
consensus CCATCCGCGACCTCGAACACTATCCTCCCTGCCTCGCCATGGCTACGGCTCCAGAAAACG
 
. : . : . : . : . : . :
JMFF028A03+ CGCGACGCCGGAAGTTCAACGGAGAGAGAAAGAGATCGAACGGCGACAGTTGATAAGCCG
JMSF004N21+ CGCGACGCCGGAAGTTCAACGGAGAGAGAAAGAGATCGAACGGCGACAGTTGATAAGCCG
JMFF048M13+ CGCGACGCCGGAAGTTCAACGGAGAGAGAAAGAGATCGAACGGCGACAGTTGATAAGCCG
                      ____________________________________________________________
consensus CGCGACGCCGGAAGTTCAACGGAGAGAGAAAGAGATCGAACGGCGACAGTTGATAAGCCG
 
. : . : . : . : . : . :
JMFF028A03+ TTTGAGAGAGAGAGAGAGAGAGAGAGAGGGAGATAGAGATAGGAAAGGGGTCCC
JMSF004N21+ TTTGAGAGAGAGAGAGAGAGAGAGAGAGGGAGATAGAGATAGGAAAGGGGTCCC
JMFF048M13+ TTTGAGAGAGAGAGAGAGAGAGAGAGAGGGAGATAGAGATAGGAAAGGGGTCCCGATTCC
                      ____________________________________________________________
consensus TTTGAGAGAGAGAGAGAGAGAGAGAGAGGGAGATAGAGATAGGAAAGGGGTCCCGATTCC