Previous Contig 002082:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048M03Sequence517002082 (2)pir|S34200|S342006e-20polygalacturonase (EC 3.2.1.15) [imported] - Arabidopsis thaliana>gb:ATEXOPB_154566010842 (2)gb:AY062447_15651033e-31Arabidopsis thaliana polygalacturonase; pectinase (At3g14060; MDC16.18) mRNA, co
JMFS031F11Sequence468002082 (2)pir|S34200|S342002e-22polygalacturonase (EC 3.2.1.15) [imported] - Arabidopsis thaliana>gb:ATEXOPB_154

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS031F11+ GCATTAAATT
                      ____________________________________________________________
consensus GCATTAAATT
 
. : . : . : . : . : . :
JMFS031F11+ GCAGATTAGCGGGAAGAGGACAGATATGGCCATTTTTGCCGCAGTCGGGTAGGTTCCAGG
JMFF048M03+ ATATGGCCATTTTTGCCGCAGTCGGGTAGGTTCCAGG
                      ____________________________________________________________
consensus GCAGATTAGCGGGAAGAGGACAGATATGGCCATTTTTGCCGCAGTCGGGTAGGTTCCAGG
 
. : . : . : . : . : . :
JMFS031F11+ TGGTGGCGCCATTGCCGTCGAAAATGCCGCCGTTGATAGTCACTCCGATGACCTGGGAGA
JMFF048M03+ TGGTGGCGCCATNGCCGTCGAAAATGCCGCCGTTGATAGTCACTCCGATGACCTGGGAGA
                      ____________________________________________________________
consensus TGGTGGCGCCATTGCCGTCGAAAATGCCGCCGTTGATAGTCACTCCGATGACCTGGGAGA
 
. : . : . : . : . : . :
JMFS031F11+ AGGTGACCCATCCGCCGTGCCCTTTGAACGCAAAGGGATCCGGTAAAGCCAACAGATTCA
JMFF048M03+ AGGTGACCCATCCGCCGTGCCCTTTGAACGCAAAGGGATCCGGTAAAGCCAACAGATTCA
                      ____________________________________________________________
consensus AGGTGACCCATCCGCCGTGCCCTTTGAACGCAAAGGGATCCGGTAAAGCCAACAGATTCA
 
. : . : . : . : . : . :
JMFS031F11+ TCTTTTGAGCATCAATGGTGATGGGACCTTTGCAAGGTCCCTGAAACCAAATCGGCCCGG
JMFF048M03+ TCTTTTGAGCATCAATGGTGATGGGACCTTTGCAAGGTCCCTGAAACCAAATCGGCCCGG
                      ____________________________________________________________
consensus TCTTTTGAGCATCAATGGTGATGGGACCTTTGCAAGGTCCCTGAAACCAAATCGGCCCGG
 
. : . : . : . : . : . :
JMFS031F11+ CCATGAATTTGCCGGCCGCCGTAATCGTGTTCGCCCCCGGTGCTTTGCATGCCGCGCCCC
JMFF048M03+ CCATGAATTTGCCGGCCGCCGTAATCGTGTTCGCCCCCGGTGCTTTGCATGCCGCGCCCC
                      ____________________________________________________________
consensus CCATGAATTTGCCGGCCGCCGTAATCGTGTTCGCCCCCGGTGCTTTGCATGCCGCGCCCC
 
. : . : . : . : . : . :
JMFS031F11+ ACGCACCCGTAAACGCCTTACTATCATCTGCTTTTCCATCGCCCTTGGCGCCAAATTTCA
JMFF048M03+ ACGCACCCGTAAACGCCTTACTATCATCTGCTTTTCCATCGCCCTTGGCGCCAAATTTCA
                      ____________________________________________________________
consensus ACGCACCCGTAAACGCCTTACTATCATCTGCTTTTCCATCGCCCTTGGCGCCAAATTTCA
 
. : . : . : . : . : . :
JMFS031F11+ TAACGTCGAAAAAGGCGGCATGCAAGCCTGTTACAAAAGACGCCAGCAAAATGCAGAACC
JMFF048M03+ TAACGTCGAAAAAGGCGGCATGCAAGCCTGTTACAAAAGACGCCAGCAAAATGCAGAACC
                      ____________________________________________________________
consensus TAACGTCGAAAAAGGCGGCATGCAAGCCTGTTACAAAAGACGCCAGCAAAATGCAGAACC
 
. : . : . : . : . : . :
JMFS031F11+ ATGCAGCTTGAATCAGTATGGATTTCATGTCTTCTCTT
JMFF048M03+ ATGCAGCTTGAATCAGTATGGATTTCATGTCTTCTCTTTATTGGTTAGAAGTATTTCCCC
                      ____________________________________________________________
consensus ATGCAGCTTGAATCAGTATGGATTTCATGTCTTCTCTTTATTGGTTAGAAGTATTTCCCC
 
. : . : . : . : . : . :
JMFF048M03+ TTTTGTTTTTGTTTTTTTTTTTTTTTGGGTTTTTACTGTTTTTTGTTTCTTCTATATTTT
                      ____________________________________________________________
consensus TTTTGTTTTTGTTTTTTTTTTTTTTTGGGTTTTTACTGTTTTTTGTTTCTTCTATATTTT