Previous Contig 002080:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013M05Sequence107014326574002080 (3)pir|E84903|E849036e-13hypothetical protein At2g46490 [imported] - Arabidopsis thaliana>gb:AC006418_153
JMFF048L24Sequence395002080 (3)pir|E84903|E849036e-09hypothetical protein At2g46490 [imported] - Arabidopsis thaliana>gb:AC006418_153408010840 (2)gb:AF117339_17695191e-27Nicotiana tabacum FtsH-like protein Pftf precursor (Pftf) mRNA, nuclear gene enc
JMFN017L21Sequence603002080 (3)pir|E84903|E849036e-13hypothetical protein At2g46490 [imported] - Arabidopsis thaliana>gb:AC006418_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF013M05- AAAAGAAACAATTAATTCAGAAAATTAAAAAGTTACACATATATATGCCTCGATCAG
JMFN017L21+ ATATATATGCCTCGATCAG
                      ____________________________________________________________
consensus AAAAGAAACAATTAATTCAGAAAATTAAAAAGTTACACATATATATGCCTCGATCAG
 
. : . : . : . : . : . :
rJMFF013M05- CTCAAACCTTGCCGGATCCTACTCGTCTTCTTCATCAATCGAGAATATCATGGAGCTATT
JMFN017L21+ CTCAAACCTGGCCGGATCCTACTCGTCTTCTTCATCAATCGAGAATATCATGGAGCTA-T
                      ____________________________________________________________
consensus CTCAAACCTTGCCGGATCCTACTCGTCTTCTTCATCAATCGAGAATATCATGGAGCTATT
 
. : . : . : . : . : . :
rJMFF013M05- TCTCTTACGCGCGATACTGTCATTGGCGGAGGCCACGGCGGCGGTGGGGGAGCAACAGGG
JMFN017L21+ NCTCTTACGCGCGATACTGTCATTGGCGGAGGCCACGGCGGCGGTGGGGGAGCAACAGGG
                      ____________________________________________________________
consensus TCTCTTACGCGCGATACTGTCATTGGCGGAGGCCACGGCGGCGGTGGGGGAGCAACAGGG
 
. : . : . : . : . : . :
rJMFF013M05- GGAAGGCGACTGGGATGCGGCGGGATCGACGGCGGCGGCGGCCAAAGCTAGACAACCGTC
JMFN017L21+ GGAAGGCGACTGGGATGCGGCGGGATCGACGGCGGCGGCGGCCAAAGCTAGACAACCGTC
                      ____________________________________________________________
consensus GGAAGGCGACTGGGATGCGGCGGGATCGACGGCGGCGGCGGCCAAAGCTAGACAACCGTC
 
. : . : . : . : . : . :
rJMFF013M05- GCTCCAGGATCGGCGGATGGGGTACGACACGTGCGCGTACTTGAGGGAATGGTGGCAATT
JMFN017L21+ GCTCCAGGATCGGCGGATGGGGTACGACACGTGCGCGTACTTGAGGGAATGGTGGCAATT
JMFF048L24+ ACGACACGTGCGCGTACTTGAGGGAATGGTGGCAATT
                      ____________________________________________________________
consensus GCTCCAGGATCGGCGGATGGGGTACGACACGTGCGCGTACTTGAGGGAATGGTGGCAATT
 
. : . : . : . : . : . :
rJMFF013M05- CCCGCGCGATTTGTGCAACGCGCAGCCGCAGTTTTTGTGGTAGGGGCGGCGTTGGATGCC
JMFN017L21+ CCCGCGCGATTTGTGCAACGCGCAGCCGCAGTTTTTGTGGTAGGGGCGGCGTTGGATGCC
JMFF048L24+ CCCGCGCGATTTGTGCAACGCGCAGCCGCAGTTTTTGTGGTAGGGGCGGCGTTGGATGCC
                      ____________________________________________________________
consensus CCCGCGCGATTTGTGCAACGCGCAGCCGCAGTTTTTGTGGTAGGGGCGGCGTTGGATGCC
 
. : . : . : . : . : . :
rJMFF013M05- GGTGTCGTGCCCGGAAATGCTCCCCTCGAACATACCCCGAAGAAACCCATCGCCGGCCGC
JMFN017L21+ GGTGTCGTGCCCGGAAATGCTCCCCTCGAACATACCCCGAAGAAACCCATCGCCGGCCGC
JMFF048L24+ GGTGTCGTGCCCGGAAATGCTCCCCTCGAACATACCCCGAAGAAACCCATCGCCGGCCGC
                      ____________________________________________________________
consensus GGTGTCGTGCCCGGAAATGCTCCCCTCGAACATACCCCGAAGAAACCCATCGCCGGCCGC
 
. : . : . : . : . : . :
rJMFF013M05- TCCGGCGTTCATTTCTGTATAGCGCCGGCCGAGCGTGCGCTTGCTTGCTCTTCAACACGA
JMFN017L21+ TCCGGCGTTCATTTCTGTATAGCGCCGGCCGAGCGTGCGCTTGCTTGCTCTTCAACACGA
JMFF048L24+ TCCGGCGTTCATTTCTGTATAGCGCCGGCCGAGCGTGCGCTTGCTTGCTCTTCAACACGA
                      ____________________________________________________________
consensus TCCGGCGTTCATTTCTGTATAGCGCCGGCCGAGCGTGCGCTTGCTTGCTCTTCAACACGA
 
. : . : . : . : . : . :
rJMFF013M05- TTTATATGAATATTATGAATTTTGTTAAACGGAGAAAAAAAAAAAAAA
JMFN017L21+ TTTATATGAATATTATGAATTTTGTTAAACGGAGAAAAAAAAAAAAAAAACAAAAGGGCA
JMFF048L24+ TTTATATGAATATTATGAATTTTGTTAAACGGAG-AAAAAAAAAAAAAAACAAAAGGGCA
                      ____________________________________________________________
consensus TTTATATGAATATTATGAATTTTGTTAAACGGAGAAAAAAAAAAAAAAAACAAAAGGGCA
 
. : . : . : . : . : . :
JMFN017L21+ GAGGAGAGATGAGATGGGAGAGAAGAAAATGGAGAAATAAATAAAAACTGGAATTGAAGC
JMFF048L24+ GAGGAGAGATGAGATGGGAGAGAAGAAAATGGAGAAATAAATAAAAACTGGAATTGAAGC
                      ____________________________________________________________
consensus GAGGAGAGATGAGATGGGAGAGAAGAAAATGGAGAAATAAATAAAAACTGGAATTGAAGC
 
. : . : . : . : . : . :
JMFN017L21+ TAGGGAAGAAAGCTAAGAAATAAAAAAAGGTTGGGTTGTTATTTT
JMFF048L24+ TAGGGAAGAAAGCTAAGAAAT-AAAAAAGGTTGGGTTGTTATTTTCTACTCTGATCTAAC
                      ____________________________________________________________
consensus TAGGGAAGAAAGCTAAGAAATAAAAAAAGGTTGGGTTGTTATTTTCTACTCTGATCTAAC