Previous Contig 002077:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006C15Sequence560002077 (7)gb:AF453322_18009001e-56Brassica oleracea zinc finger protein LSD1 (LSD1) mRNA, complete cds.
JMFF040L23Sequence573002077 (7)gb:AF453322_18009006e-60Brassica oleracea zinc finger protein LSD1 (LSD1) mRNA, complete cds.628002077 (7)gb:AF453322_18009005e-19Brassica oleracea zinc finger protein LSD1 (LSD1) mRNA, complete cds.
JMFF048L10Sequence479002077 (7)gb:AX093386_14611134e-16Sequence 5 from Patent WO0118061.320021839
JMFN037M17Sequence502002077 (7)gb:AF453322_18009005e-11Brassica oleracea zinc finger protein LSD1 (LSD1) mRNA, complete cds.
JMFN037O15Sequence592002077 (7)gb:AF453322_18009001e-33Brassica oleracea zinc finger protein LSD1 (LSD1) mRNA, complete cds.
JMSF045O10Sequence653000613 (77)pir|S07942|CDKVe-100chlorophyll a/b-binding protein precursor - cucumber (fragment)289002077 (7)gb:AY080824_15685190.014Arabidopsis thaliana putative zinc-finger protein Lsd1 (At4g20380) mRNA, complet

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN037M17+ CATCATGAAAATGTAATATCC
rJMFF040L23- TATGTTCTTCCACTATATAATAGAGGGCANNATCNCATCATGAANATGTAATATCC
                      ____________________________________________________________
consensus TATGTTCTTCCACTATATAATAGAGGGCANNATCNCATCATGAAAATGTAATATCC
 
. : . : . : . : . : . :
JMFN037M17+ GTAGCCATAATTCCGACGATGAACAATCAAACAAATTGCTCAAGTCCCAAGCGCTCAATC
rJMFF040L23- GTAGCCATAATTCCGACGATGAACAATCAAACNANTTGCTCAAGTCCCAAGCGCTCAATC
JMFN037O15+ ACGATGAACAATCAAAC-AAATGCTCAAGTCCCAAGCGCTCAATC
                      ____________________________________________________________
consensus GTAGCCATAATTCCGACGATGAACAATCAAACAAATTGCTCAAGTCCCAAGCGCTCAATC
 
. : . : . : . : . : . :
JMFN037M17+ ATTTGGAAGATGTGAACTCGGTTCAAATTTCACCCAAGAATCTTCGTAGATGAATTGCAT
rJMFF040L23- ATTTGGAAGATGTGAACTCGGTTCANATTTCACCCAANAATCTTCGNAGATGAATTGCAT
rJMSF045O10- AGATGAATTGCAT
JMFN037O15+ ATTTGGAAGATGTGAACTCGGTTCAAATTTCACCCAAGAATCTTCGTAGATGAATTGCAT
                      ____________________________________________________________
consensus ATTTGGAAGATGTGAACTCGGTTCAAATTTCACCCAAGAATCTTCGTAGATGAATTGCAT
 
. : . : . : . : . : . :
JMFN037M17+ GCTTTATAATATTCACCTACAAATTATTACATATATAATATGTGCCATCCATCTCTACAC
rJMFF040L23- GCTTTATAATATTANACTACNAATTATTACNTATATAATATGTACCATCCATCTCTACAC
rJMSF045O10- GCTTTATAATATTAAACTACAAATNATTACNTATATAATATGTACCATCCATCTCTANAC
JMFN037O15+ GCTTTATAATATTAAACTACAAATTATTACATATATAATATGTACCATCCATCTCTACAC
                      ____________________________________________________________
consensus GCTTTATAATATTAAACTACAAATTATTACATATATAATATGTACCATCCATCTCTACAC
 
. : . : . : . : . : . :
JMFN037M17+ TCATCTCTCCAATAAAG-CAAGCCACATTCCCAAACGCCATCACTAATGAGACCAACAGG
rJMFF040L23- TCATCTCTCCAATAAAG-CAAGCCNCATTCCCAAACGCCATCACTAATGANACCAACAGG
rJMSF045O10- TCGTCTCTCCAANAAAGACNAGCCACATTCCCAAACGCCATCACTANTGAGACCAACNGG
JMFN037O15+ TCATCTCTCCAATAAAG-CAAGCCACATTCCCAAACGCCATCACTAATGAGACCAACAGG
                      ____________________________________________________________
consensus TCATCTCTCCAATAAAG-CAAGCCACATTCCCAAACGCCATCACTAATGAGACCAACAGG
 
. : . : . : . : . : . :
JMFN037M17+ TGGAATTCTTGTTTCGTCGAAAGGTCTATGTTGTCGTTGTCACACCAACAACAACATTGC
rJMFF040L23- TGGAATTCTTGTTTCGTCGANAGGTCTATGTTGTCGTTGTCACACCAACAACAACATTGC
rJMSF045O10- TGGAATTCTTGGTTCGTCAAAAGGNCTATGTTGTCNTTGTCACACCNACAACAACATTGC
JMFN037O15+ TGGAATTCTTGTTTCGTCGAAAGGTCTATGTTGTCGTTGTCACACCAACAACAACATTGC
JMFF040L23+ TGTCACACCAACAACAACATTGC
JMFF006C15+ ACAACATTGC
                      ____________________________________________________________
consensus TGGAATTCTTGTTTCGTCGAAAGGTCTATGTTGTCGTTGTCACACCAACAACAACATTGC
 
. : . : . : . : . : . :
JMFN037M17+ TCACCAGCTTCCCACTTTCATCAACAGACATGGGGTTTTGAACAACAACAGTTTGATTTT
rJMFF040L23- TCACCANCTTCCCACTTTCATCAACAGACATGGGGTTTTGAACAACAACAGTTTGATTCT
rJMSF045O10- TCACCAGCTTCCCACTTTCATCAANAGACATGGGGTTTTGAACAACTACAGTTNGATTCT
JMFN037O15+ TCACCAGCTTCCCACTTTCATCAACAGACATGGGGTTTTGAACAACAACAGTTTGATTCT
JMFF040L23+ TCACCAGCTTCCCACTTTCATCAACAGACATGGGGTTTTGAACAACAACAGTTTGATTCT
JMFF006C15+ TCACCAGCTTCCCACTTTCATCAACAGACATGGGGTTTTGAACAACAACAGTTTGATTNT
                      ____________________________________________________________
consensus TCACCAGCTTCCCACTTTCATCAACAGACATGGGGTTTTGAACAACAACAGTTTGATTCT
 
. : . : . : . : . : . :
JMFN037M17+ GAGAACGGGGTGCAGCTGTGGAAGAAGGTGGGGCAGATGAAGATGTAGCAGATCCATTAG
rJMFF040L23- GANAACGGGGTGCAGCTGTGGAAGAAGGTGGGGCAGATGAAGATGTAGCANATCCATTAG
rJMSF045O10- GAGAACGGNGTGC
JMFN037O15+ GAGAACGGGGTGCAGCTGTGGAAGAAGGTGGGGCAGATGAAGATGTAGCAGATCCATTAG
JMFF040L23+ GAGAACGGGGTGCAGCTGTGGAAGAAGGTGGGGCAGATGAAGATGTAGCAGATCCATTAG
JMFF006C15+ GAGAACGGGGTGCAGCTGTGGAAGAAGGTGGGGCAGATGAAGATGTAGCAGATCCATTAG
                      ____________________________________________________________
consensus GAGAACGGGGTGCAGCTGTGGAAGAAGGTGGGGCAGATGAAGATGTAGCAGATCCATTAG
 
. : . : . : . : . : . :
JMFN037M17+ GTGGGTGGGAAGGAATGGGCACTCTCGCATCTCCCGCATTAACATTGGTGATGAAGTGAC
rJMFF040L23- GTGGGTGGGAANGAATGGGCACTCTCNCATCTCCCGCATTAACATTGGTGATGAANTGAC
JMFN037O15+ GTGGGTGGGAAGGAATGGGCACTCTCGCATCTCCCGCATTAACATTGGTGATGAAGTGAC
JMFF040L23+ GTGGGTGGGAAGGAATGGGCACTCTCGCATCTCCCGCATTAACATTGGTGATGAAGTGAC
JMFF006C15+ GTGGGTGGGAAGGAATGGGCACTCTCGCATCTCCCGCATTAACATTGGTGATGAAGTGAC
                      ____________________________________________________________
consensus GTGGGTGGGAAGGAATGGGCACTCTCGCATCTCCCGCATTAACATTGGTGATGAAGTGAC
 
. : . : . : . : . : . :
JMFN037M17+ AT
rJMFF040L23- ATACTGCACACTTAACTGATGGAGCTCCNCATGGATACATCANCATTGTACGACAGNTCC
JMFN037O15+ ATACTGCACACTTAACTGATGGAGCTCCACATGGATACATCAGCATTGTACGACAGTTCC
JMFF040L23+ ATACTGCACACTTAACTGATGGAGCTCCACATGGATACATCAGCATTGTACGACAGTTCC
JMFF006C15+ ATACTGCACACTTAACTGATGGAGCTCCACATGGATACATCAGCATTGTACGACAGTTCC
                      ____________________________________________________________
consensus ATACTGCACACTTAACTGATGGAGCTCCACATGGATACATCAGCATTGTACGACAGTTCC
 
. : . : . : . : . : . :
rJMFF040L23- CACNATTGATATGAGCAAACTGATTTGGTCCAG
JMFN037O15+ CACAATTGATATGAGCAAACTGATTTGGTCCAGGCACAAGGTTCACCGTATGACAGCAGG
JMFF040L23+ CACAATTGATATGAGCAAACTGATTTGGTCCAGGCACAAGGTTCACCGTATGACAGCAGG
JMFF006C15+ CACAATTGATATGAGCAAACTGATTTGGTCCAGGCACAAGGTTCACCGTATGACAGCAGG
                      ____________________________________________________________
consensus CACAATTGATATGAGCAAACTGATTTGGTCCAGGCACAAGGTTCACCGTATGACAGCAGG
 
. : . : . : . : . : . :
JMFN037O15+ AGCATCTTA
JMFF040L23+ AGCATCTTACACTGGTTGCTCCCCGTGGATGCATCAGAAGTGTGCGGCAACCCCCACATA
JMFF006C15+ AGCATCTTACACTGGTTGCTCCCCGTGGATGCATCAGAAGTGTGCGGCAACCCCCACATA
                      ____________________________________________________________
consensus AGCATCTTACACTGGTTGCTCCCCGTGGATGCATCAGAAGTGTGCGGCAACCCCCACATA
 
. : . : . : . : . : . :
JMFF040L23+ TCAGTTGAGCCATCTGACCCATCTCCATTCCAGGAGGCGGCACAGGAGTGAGGGCATTGC
JMFF006C15+ TCAGTTGAGCCATCTGACCCATCTCCATTCCAGGAGGCGGCACAGGAGTGAGGGCATTGC
JMFF048L10+ CCATTTCCATTGCAGGAGGCGGGACAGGAGTGAGGGCATTGC
                      ____________________________________________________________
consensus TCAGTTGAGCCATCTGACCCATCTCCATTCCAGGAGGCGGCACAGGAGTGAGGGCATTGC
 
. : . : . : . : . : . :
JMFF040L23+ ACACTGCACAGCAGACATTTGTAGCTCCTCTGGGATAAAGAAGAATAGTCCTACACCCAC
JMFF006C15+ ACACTGCACAGCAGACATTTGTAGCTCCTCTGGGATAAAGAAGAATAGTCCTACACCCAC
JMFF048L10+ AGACTGCACAGCAGACATTTGAGGCTCCCCTGGGATAAAGAAGAATAGTCCTACACCCGT
                      ____________________________________________________________
consensus ACACTGCACAGCAGACATTTGTAGCTCCTCTGGGATAAAGAAGAATAGTCCTACACCCAC
 
. : . : . : . : . : . :
JMFF040L23+ TGCAAACCAACTGGCTCTGCATATCA
JMFF006C15+ TGCAAACCAACTGGCTCTGCATATCA
JMFF048L10+ TACAAACCACCTGGCTCTGCATATCACTGATGAAGGAGCAAATCTGAAGCCCAAGAGACA
                      ____________________________________________________________
consensus TGCAAACCAACTGGCTCTGCATATCACTGATGAAGGAGCAAATCTGAAGCCCAAGAGACA
 
. : . : . : . : . : . :
JMFF048L10+ AGATTGATCAGATAAGCAAATTACAGAGAAACCGACGAACGATACTGCGATTCCGAACGG
                      ____________________________________________________________
consensus AGATTGATCAGATAAGCAAATTACAGAGAAACCGACGAACGATACTGCGATTCCGAACGG
 
. : . : . : . : . : . :
JMFF048L10+ AAATCTTATCCGAGTTTCCTTTATTAAGAATAATAAAACAAATAGAAAGAAGAATATTCT
                      ____________________________________________________________
consensus AAATCTTATCCGAGTTTCCTTTATTAAGAATAATAAAACAAATAGAAAGAAGAATATTCT
 
. : . : . : . : . : . :
JMFF048L10+ TCTCCGCTTAACACGAATTCGCGTTCTTTGACTTTCAGGTAAGGGAAGGGCTTTGAATTC
                      ____________________________________________________________
consensus TCTCCGCTTAACACGAATTCGCGTTCTTTGACTTTCAGGTAAGGGAAGGGCTTTGAATTC
 
. : . : . : . : . : . :
JMFF048L10+ AACGATGAAGAGACATAATTTATCCAATTGAATTGATGGAAACTCGTGATGAAGATTTGT
                      ____________________________________________________________
consensus AACGATGAAGAGACATAATTTATCCAATTGAATTGATGGAAACTCGTGATGAAGATTTGT
 
. : . : . : . : . : . :
JMFF048L10+ AGCGTTTTCCTTCCTGGAGGCTACCGAGCACACAGAAGATACGACCCGAATTCGACAATC
                      ____________________________________________________________
consensus AGCGTTTTCCTTCCTGGAGGCTACCGAGCACACAGAAGATACGACCCGAATTCGACAATC