Previous Contig 002070:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048J23Sequence371002070 (14)pir|T07391|T073915e-30probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t332010833 (2)gb:AJ606313_18119591e-18Lycopersicon esculentum mRNA for alpha glucosidase II (gluII gene).
JMFS007F04Sequence510002070 (14)pir|T07391|T073913e-50probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS022H11Sequence627002070 (14)pir|T07391|T073912e-71probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS043A10Sequence601002070 (14)pir|T07391|T073913e-67probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS054D10Sequence632002070 (14)pir|T07391|T073912e-72probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS059F04Sequence626002070 (14)pir|T07391|T073917e-71probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS088A04Sequence664002070 (14)pir|T07391|T073916e-79probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS088G02Sequence621002070 (14)pir|T07391|T073917e-71probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS089D05Sequence639002070 (14)pir|T07391|T073918e-78probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS098E12Sequence624002070 (14)pir|T07391|T073912e-71probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS105F09Sequence603002070 (14)pir|T07391|T073911e-61probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS120F07Sequence618002070 (14)pir|T07391|T073916e-81probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS140H02Sequence635002070 (14)pir|T07391|T073912e-71probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t
JMFS151E05Sequence615002070 (14)pir|T07391|T073915e-79probable alpha-glucosidase (EC 3.2.1.20) - potato>gb:STJ001374_1722801 Solanum t

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS120F07+ GCTTCGAAACCTTTCCTCCCAATCATCCCCTTC
JMFS140H02+ TTGAATCAGTGTGGCTTCGAAACCTTTCCTCCCAATCATCCCCTTC
JMFS151E05+ TTCCTCCCAATCATCCCCTTC
JMFS089D05+ TCCCAATCATCCCCTTC
JMFS088A04+ TTCCTCCCAATCATCCCCTTC
                      ____________________________________________________________
consensus TTGAATCAGTGTGGCTTCGAAACCTTTCCTCCCAATCATCCCCTTC
 
. : . : . : . : . : . :
JMFS120F07+ CTGCTTCTTCCTCAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS140H02+ CTGCTTCTTCCTCAG-TCGTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS151E05+ CTGCTTCTTCCTCAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS089D05+ CTGCTTCTTCCTCAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS088A04+ CTGCTTCTTCCTCAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS043A10+ CAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS054D10+ TCAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS098E12+ CTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS088G02+ CGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS105F09+ GCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS022H11+ GCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
JMFS059F04+ GAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
                      ____________________________________________________________
consensus CTGCTTCTTCCTCAGCTGCTCGAAATCAAACAATCCATTCGAGTTTATGGAAACTACTCT
 
. : . : . : . : . : . :
JMFS120F07+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS140H02+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS151E05+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS089D05+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS088A04+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS043A10+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCGAAAAGGGTCGTGCCTCAGCACTCCCT
JMFS054D10+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS098E12+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS088G02+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS105F09+ CTTCCCACTA-CCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS022H11+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
JMFS059F04+ CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
                      ____________________________________________________________
consensus CTTCCCACTACCCTTCTCCCTCACGAAAACCTCG-AAAGGGTCGTGCCTCAGCACTCCCT
 
. : . : . : . : . : . :
JMFS120F07+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS140H02+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS151E05+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS089D05+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS088A04+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS043A10+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS054D10+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS098E12+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS088G02+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS105F09+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS007F04+ CAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS022H11+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
JMFS059F04+ CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
                      ____________________________________________________________
consensus CGTACTCATCACTCAAATAAATCACAGATGAAGCGGACGAATCTCCATCCAACGTCTCTT
 
. : . : . : . : . : . :
JMFS120F07+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS140H02+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS151E05+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS089D05+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS088A04+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS043A10+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS054D10+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS098E12+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS088G02+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS105F09+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS007F04+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS022H11+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
JMFS059F04+ CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
                      ____________________________________________________________
consensus CCTTAAGTCTCTTTAACCAAAGCTTTTTGCTTGAAAACTCATCCACTATCACATCAGGCA
 
. : . : . : . : . : . :
JMFS120F07+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS140H02+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS151E05+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS089D05+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS088A04+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS043A10+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS054D10+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS098E12+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS088G02+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS105F09+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS007F04+ CTTCGAACATCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS022H11+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFS059F04+ CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
JMFF048J23+ CAGCCTCATTA
                      ____________________________________________________________
consensus CTTCGAACCTCTTCTTGGGCGGGTCCAAACTCGGGTCCTCGTCGATCTTCAGCCTCATTA
 
. : . : . : . : . : . :
JMFS120F07+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS140H02+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS151E05+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS089D05+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS088A04+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS043A10+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS054D10+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS098E12+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS088G02+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS105F09+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS007F04+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS022H11+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFS059F04+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
JMFF048J23+ TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
                      ____________________________________________________________
consensus TGCCATCTTGGTACACAGAGATAGAGAGAAGGAGCGGCTTGACTGGATCTTCGCTCTCTG
 
. : . : . : . : . : . :
JMFS120F07+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS140H02+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS151E05+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS089D05+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS088A04+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS043A10+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS054D10+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS098E12+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS088G02+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS105F09+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS007F04+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS022H11+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFS059F04+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
JMFF048J23+ AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
                      ____________________________________________________________
consensus AGCTCCCTTCTTTGGGGAGGAGCTTGGCGACCAGATCTCCGTCGGATACGGAGACATAGG
 
. : . : . : . : . : . :
JMFS120F07+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS140H02+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS151E05+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS089D05+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS088A04+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS043A10+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS054D10+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS098E12+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS088G02+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS105F09+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS007F04+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS022H11+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFS059F04+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
JMFF048J23+ AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
                      ____________________________________________________________
consensus AGGCGCGTAAATTACACGTCCCGGGCTTGCGGGAACGGGCGCGTTTACAGAAGGGAGTCT
 
. : . : . : . : . : . :
JMFS120F07+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS140H02+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS151E05+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS089D05+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS088A04+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS043A10+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS054D10+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS098E12+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS088G02+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS105F09+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS007F04+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS022H11+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFS059F04+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
JMFF048J23+ GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
                      ____________________________________________________________
consensus GATTGCAGTTCCGGAATTCTTCTTTCTTCCAGGAGAAGACGGAAACTGCGAGTAGGAGGA
 
. : . : . : . : . : . :
JMFS120F07+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAAC
JMFS140H02+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGA
JMFS151E05+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACC
JMFS089D05+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS088A04+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS043A10+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS054D10+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS098E12+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS088G02+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS105F09+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS007F04+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS022H11+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFS059F04+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
JMFF048J23+ GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
                      ____________________________________________________________
consensus GAAGGAGGATCTGGAAACAAAGGCTTAGAGGTTTCATGACGTGAACGGCGACCATCGCCG
 
. : . : . : . : . : . :
JMFS089D05+ GCGGCGATCAAGAGGCCAGTG
JMFS088A04+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAGC
JMFS043A10+ GCGGCGATCAAGA
JMFS054D10+ GCGGCGATCAAGAGGCCAGTG-GGAGTGATGGGGGTCAGTCAGCG
JMFS098E12+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAG
JMFS088G02+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCA
JMFS105F09+ GCGGCGATCAAGAGGCCAGTG
JMFS007F04+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAG
JMFS022H11+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAGCG
JMFS059F04+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAGCG
JMFF048J23+ GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAGCGAGGTCCTTAGGATTT
                      ____________________________________________________________
consensus GCGGCGATCAAGAGGCCAGTGTGGAGTGATGGGGGTCAGTCAGCGAGGTCCTTAGGATTT