Previous Contig 002065:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031J22Sequence562002065 (2)gb:AY059789_15646363e-20Arabidopsis thaliana unknown protein (At3g63340) mRNA, complete cds.772011167 (3)gb:AY059789_15646368e-42Arabidopsis thaliana unknown protein (At3g63340) mRNA, complete cds.
JMFF048I15Sequence567002065 (2)gb:AY059789_15646363e-20Arabidopsis thaliana unknown protein (At3g63340) mRNA, complete cds.513011167 (3)gb:AY059789_15646362e-25Arabidopsis thaliana unknown protein (At3g63340) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF031J22+ TGGAGGAACAATTTCTTGTATGTGTTGAATACAACATGAAGGAAA
JMFF048I15+ TGAATACAACATGAAGGAAA
                      ____________________________________________________________
consensus TGGAGGAACAATTTCTTGTATGTGTTGAATACAACATGAAGGAAA
 
. : . : . : . : . : . :
JMFF031J22+ AAGTAATCCAAAAACTTTTCTGAAGCCATCTTGCTTGCTTCCTTGCCCCCATGACCATCA
JMFF048I15+ AAGTAATCCAAAAACTTTTCTGAAGCCATCTTGCTTGCTTCCTGGCCCCCATGACCATCA
                      ____________________________________________________________
consensus AAGTAATCCAAAAACTTTTCTGAAGCCATCTTGCTTGCTTCCTTGCCCCCATGACCATCA
 
. : . : . : . : . : . :
JMFF031J22+ AATACTGCCCCCACAGCAACACTGACATCTAAAACCGGAATTGTTACATTAGGATAGCAA
JMFF048I15+ AATACTGCCCCCACAGCAACACTGACATCTAAAACCGGAATTGTTACATTAGGATAGCAA
                      ____________________________________________________________
consensus AATACTGCCCCCACAGCAACACTGACATCTAAAACCGGAATTGTTACATTAGGATAGCAA
 
. : . : . : . : . : . :
JMFF031J22+ ATAACACGGTCTTCCTGGTATTTCTTGTGGCCCTGAAGTGTAGCAAACTGGCAGCTCCCT
JMFF048I15+ ATAACACGGTCTTCCTGGTATTTCTTGTGGCCCTGAAGTGTAGCAAACTGGCAGCTCCCT
                      ____________________________________________________________
consensus ATAACACGGTCTTCCTGGTATTTCTTGTGGCCCTGAAGTGTAGCAAACTGGCAGCTCCCT
 
. : . : . : . : . : . :
JMFF031J22+ TCTTTGAGTGCTTTCTTCTCAGGGGAAGCCAATAGAATCCATTGAGGGCATTCAGGCAAT
JMFF048I15+ TCTTTGAGTGCTTTCTTCTCAGGGGAAGCCAATAGAATCCATTGAGGGCATTCAGGCAAT
                      ____________________________________________________________
consensus TCTTTGAGTGCTTTCTTCTCAGGGGAAGCCAATAGAATCCATTGAGGGCATTCAGGCAAT
 
. : . : . : . : . : . :
JMFF031J22+ CCAAAAAAGGCTGGAGCACCTCCTTCATCATAAGCTCTCATACAGGAAACAAACACATCG
JMFF048I15+ CCAAAAAAGGCTGGAGCACCTCCTTCATCATAAGCTCTCATACAGGAAACAAACACATCG
                      ____________________________________________________________
consensus CCAAAAAAGGCTGGAGCACCTCCTTCATCATAAGCTCTCATACAGGAAACAAACACATCG
 
. : . : . : . : . : . :
JMFF031J22+ TGAGCATAGCCCGAGGCAGCAGAGAAAAACACTCCTACGAGAACTATGATCTTAAATCTG
JMFF048I15+ TGAGCATAGCCCGAGGCAGCAGAGAAAAACACTCCTACGAGAACTATGATCTTAAATCTG
                      ____________________________________________________________
consensus TGAGCATAGCCCGAGGCAGCAGAGAAAAACACTCCTACGAGAACTATGATCTTAAATCTG
 
. : . : . : . : . : . :
JMFF031J22+ TCCATTATTCACTCCACACAAAATTAGGTTCCTGCAGAATTCCAAACTAGACATTAGGTT
JMFF048I15+ TCCATTATTCACTCCACACAAAATTAGGTTCCTGCAGAATTCCAAACTAGACATTAGGTT
                      ____________________________________________________________
consensus TCCATTATTCACTCCACACAAAATTAGGTTCCTGCAGAATTCCAAACTAGACATTAGGTT
 
. : . : . : . : . : . :
JMFF031J22+ AGAGCTAAATCTGACGGCTTGATCGGCACGGCGTCCGGCGACATCCCTGATTTCGGAGTG
JMFF048I15+ AGAGCTAAATCTGACGGCTTGATCGGCACGGCGTCCGGCGACATCCCTGATTTCGGAGTG
                      ____________________________________________________________
consensus AGAGCTAAATCTGACGGCTTGATCGGCACGGCGTCCGGCGACATCCCTGATTTCGGAGTG
 
. : . : . : . : . : . :
JMFF031J22+ AACTCGAGGGAAATGATCCTAACCGGAGAGGGAAAAT
JMFF048I15+ AACTCGAGGGAAATGATCCTAACCGGAGAGGGAAAATAAAATTGTCCGAAATCTATTCAT
                      ____________________________________________________________
consensus AACTCGAGGGAAATGATCCTAACCGGAGAGGGAAAATAAAATTGTCCGAAATCTATTCAT