Previous Contig 002064:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF008P09Sequence590002064 (35)gb:AX647997_14725856e-93Sequence 53 from Patent WO02103001.760002064 (35)gb:AX647945_1472573e-119Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMFF009H10Sequence483002064 (35)gb:AX647983_14725814e-88Sequence 39 from Patent WO02103001.
JMFF012G03Sequence484002064 (35)gb:AX647997_14725856e-72Sequence 53 from Patent WO02103001.720002064 (35)gb:AX647979_14725793e-89Sequence 35 from Patent WO02103001.
JMFF014I05Sequence593002064 (35)gb:AX647997_14725856e-93Sequence 53 from Patent WO02103001.807002064 (35)gb:AX647975_1472577e-109Sequence 31 from Patent WO02103001.
JMFF017A01Sequence591002064 (35)gb:AX647997_14725856e-93Sequence 53 from Patent WO02103001.774002064 (35)gb:AX647945_1472573e-102Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMFF017I11Sequence592002064 (35)gb:AX647997_14725857e-92Sequence 53 from Patent WO02103001.779002064 (35)gb:AX647945_1472573e-105Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMFF021G06Sequence532002064 (35)gb:AX647997_14725852e-81Sequence 53 from Patent WO02103001.708002064 (35)gb:AX647945_14725732e-89Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMFF022B13Sequence458014504gb:AX647979_14725791e-14Sequence 35 from Patent WO02103001.593002064 (35)gb:AX647977_14725783e-57Sequence 33 from Patent WO02103001.
JMFF025D15Sequence592002064 (35)gb:AX647997_14725856e-93Sequence 53 from Patent WO02103001.814002064 (35)gb:AX647945_1472573e-113Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMFF034L11Sequence540002064 (35)gb:AX647997_14725853e-83Sequence 53 from Patent WO02103001.351002064 (35)gb:AX647977_14725787e-23Sequence 33 from Patent WO02103001.
JMFF036H22Sequence548002064 (35)gb:AX647997_14725853e-84Sequence 53 from Patent WO02103001.660002064 (35)gb:AX647975_14725779e-67Sequence 31 from Patent WO02103001.
JMFF038D08Sequence540002064 (35)gb:AX647997_14725853e-83Sequence 53 from Patent WO02103001.703002064 (35)gb:AX647975_14725774e-89Sequence 31 from Patent WO02103001.
JMFF047A19Sequence514002064 (35)gb:AX647997_14725856e-76Sequence 53 from Patent WO02103001.439002064 (35)gb:AX647979_14725795e-24Sequence 35 from Patent WO02103001.
JMFF047N21Sequence626002064 (35)gb:AX647997_14725856e-97Sequence 53 from Patent WO02103001.634002064 (35)gb:AX647945_14725732e-64Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMFF048I13Sequence501002064 (35)gb:AX647997_14725854e-72Sequence 53 from Patent WO02103001.492002064 (35)gb:AX647977_14725783e-41Sequence 33 from Patent WO02103001.
JMFN028F05Sequence415002064 (35)gb:AX647979_14725791e-29Sequence 35 from Patent WO02103001.
JMFN044J10Sequence638002064 (35)gb:AX647975_14725775e-84Sequence 31 from Patent WO02103001.
JMSF001N15Sequence209018244gb:AX647997_14725855e-08Sequence 53 from Patent WO02103001.739002064 (35)gb:AX647975_1472577e-101Sequence 31 from Patent WO02103001.
JMSF017E05Sequence592002064 (35)gb:AX647997_14725856e-93Sequence 53 from Patent WO02103001.764002064 (35)gb:AX647945_1472573e-107Sequence 1 from Patent WO02103001.>gb:AY057660_1564073 Arabidopsis thaliana AT5g
JMSF051L06Sequence635002064 (35)gb:AX647997_14725857e-93Sequence 53 from Patent WO02103001.722002064 (35)gb:AX647975_1472577e-100Sequence 31 from Patent WO02103001.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF047A19- CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTT
rJMFF047N21- ACCCTGGAGAGTTTTTTTTTTTT
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTT
 
. : . : . : . : . : . :
rJMFF047A19- TT----TTGATGAAGATAAAATGAGCATTGATTCAAATAAGAAAACCATCCAAACCATGA
rJMFF047N21- TTTTGGTTGAACAAGATAAAATGAGCATTGATTCAAATAAGAAAACCATCCAAACCATGA
rJMFF017I11- TGAGCATTGATTCAAATAAGAAAACCATCCAAACCATGA
rJMFF017A01- CATTGATTCAAATAAGAAAACCATCCAAACCATGA
rJMSF017E05- AACCATGA
rJMSF001N15- GA
rJMSF051L06- GA
rJMFF021G06- AATAAGAAAACCATCCAAACCATGA
rJMFF038D08- AATAAGAAAACCATCCAAACCATGA
rJMFF012G03- TGATTCANATAAGAAAACCATCCAAACCATGA
rJMFF022B13- GATTCAAATAAGAAAACCATCCAAACCATGA
rJMFF036H22- CATGA
rJMFF048I13- AAGAAAACCATCCAAACCATGA
JMFN028F05+ AAGAAAACCATCCAAACCATGA
rJMFF014I05- CATTGATTCAAATAAGAAAACCATCCAAACCATGA
rJMFF025D15- AATAAGAAAACCATCCAAACCATGA
                      ____________________________________________________________
consensus TTTTGGTTGATGAAGATAAAATGAGCATTGATTCAAATAAGAAAACCATCCAAACCATGA
 
. : . : . : . : . : . :
rJMFF047A19- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF047N21- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF017I11- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTT-TCAGC
rJMFF017A01- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMSF017E05- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMSF001N15- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMSF051L06- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF021G06- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF038D08- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF012G03- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
JMFN044J10+ AACTTGGCCAAGACCTTATGGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF022B13- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF036H22- TTGTACATAAANTTGGCCAAGACCTTATTGGGTTCAAAGGNAGAATAGTTTNTCATCAGC
rJMFF048I13- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
JMFN028F05+ TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF034L11- CCAAGACCTTNTTGGGTTCNGAGGNAGAATAGTTTTTCATCANC
rJMFF014I05- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF025D15- TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
rJMFF008P09- TAGTTTTTC-TCAGC
                      ____________________________________________________________
consensus TTGTACATAAACTTGGCCAAGACCTTATTGGGTTCAAAGGCAGAATAGTTTTTCATCAGC
 
. : . : . : . : . : . :
rJMFF047A19- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF047N21- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF017I11- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF017A01- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMSF017E05- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMSF001N15- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMSF051L06- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF021G06- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF038D08- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF012G03- TAANATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
JMFN044J10+ TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF022B13- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF036H22- TANNATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF048I13- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
JMFN028F05+ TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF034L11- TANGATAGGAAAAANAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF014I05- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF025D15- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
rJMFF008P09- TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
                      ____________________________________________________________
consensus TAAGATAGGAAAAACAGGAAGATAAATATGCCCTCCAAACAAAGCAACTTTTCTTCAACA
 
. : . : . : . : . : . :
rJMFF047A19- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF047N21- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF017I11- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF017A01- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMSF017E05- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMSF001N15- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMSF051L06- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF021G06- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF038D08- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF012G03- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCANCAGCA
JMFN044J10+ TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF022B13- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF036H22- TTTTTATAGGGTANNAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCANCAGNA
rJMFF048I13- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
JMFN028F05+ TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF034L11- TTTTTANAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCNTTGNCATCAGCAGCA
rJMFF014I05- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF025D15- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
rJMFF008P09- TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
                      ____________________________________________________________
consensus TTTTTATAGGGTACAAGTACATCAGCTTCAAACACCACTCATTCCTTGCCATCAGCAGCA
 
. : . : . : . : . : . :
rJMFF047A19- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF047N21- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF017I11- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF017A01- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMSF017E05- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMSF001N15- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMSF051L06- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF021G06- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF038D08- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF012G03- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
JMFN044J10+ CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF022B13- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF036H22- CGGAGCGATCCAAGNTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF048I13- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
JMFN028F05+ CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF034L11- CGGANCGATCCAAGTTGCACCGGAGNTTGGGTTCCCACCACCTTGGAAGATCCNTATGNG
rJMFF014I05- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF025D15- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
rJMFF008P09- CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
                      ____________________________________________________________
consensus CGGAGCGATCCAAGTTGCACCGGAGCTTGGGTTCCCACCACCTTGGAAGATCCATATGTG
 
. : . : . : . : . : . :
rJMFF047A19- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF047N21- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF017I11- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF017A01- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMSF017E05- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMSF001N15- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMSF051L06- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF021G06- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF038D08- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF012G03- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGNTCCTTGATCCAGAAGTAGGTG
JMFN044J10+ GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF022B13- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF036H22- GANAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGNTCCTTGATCCAGAANTAGGTG
rJMFF048I13- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAAAAGTAGGTG
JMFN028F05+ GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF034L11- GANAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCNAGAAGNAGGTG
rJMFF014I05- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF025D15- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
rJMFF008P09- GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
                      ____________________________________________________________
consensus GAGAGATCAACGCCTTGAGCTTTCTCCTTCTCGAGCTGTTCCTTGATCCAGAAGTAGGTG
 
. : . : . : . : . : . :
rJMFF047A19- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCC
rJMFF047N21- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF017I11- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF017A01- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMSF017E05- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMSF001N15- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMSF051L06- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF021G06- ATTCTCAACCCTTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF038D08- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF012G03- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
JMFN044J10+ ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF022B13- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF036H22- ATTCNCAACCCGNCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF048I13- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAAA
JMFN028F05+ ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF034L11- ATTCTCAACCCGTCCTTCAATCTCATCGNTGGAGCCCAACCAAGNTTCTCCTTTATGAGA
rJMFF014I05- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF025D15- ATTCTCAACCCTTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
rJMFF008P09- ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
                      ____________________________________________________________
consensus ATTCTCAACCCGTCCTTCAATCTCATCGTTGGAGCCCAACCAAGTTTCTCCTTTATGAGA
 
. : . : . : . : . : . :
rJMFF047N21- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF017I11- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF017A01- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMSF017E05- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMSF001N15- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMSF051L06- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF021G06- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF038D08- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF012G03- GTGTTGTCAGAGNTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCNGCAGC
JMFN044J10+ GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF022B13- GTGTTGTCAGAGTTTCNACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF036H22- GTGTTGTCAGAGNTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCNGCAGN
rJMFF048I13- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAG
JMFN028F05+ GTG
rJMFF034L11- GTGTTGT
rJMFF014I05- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF025D15- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
rJMFF008P09- GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
                      ____________________________________________________________
consensus GTGTTGTCAGAGTTTCGACCACGGACACCTTCTGGCCCGGGAATGTGGTGAATCGGCAGC
 
. : . : . : . : . : . :
rJMFF047N21- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF017I11- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF017A01- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMSF017E05- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMSF001N15- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMSF051L06- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF021G06- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF038D08- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF012G03- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
JMFN044J10+ CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF022B13- CTCTTCTCATCAAAGCTAAGAACCATCTCANCCATCTCATTCATGCTAACCATCTCATCA
rJMFF036H22- CTCTTCTCATCAAAGCTAAGAACCATCTCANCCATCTCATTCATGCTAACCATCTCATCA
rJMFF014I05- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF025D15- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
rJMFF008P09- CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
                      ____________________________________________________________
consensus CTCTTCTCATCAAAGCTAAGAACCATCTCAGCCATCTCATTCATGCTAACCATCTCATCA
 
. : . : . : . : . : . :
rJMFF047N21- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF017I11- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF017A01- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMSF017E05- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMSF001N15- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMSF051L06- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF021G06- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF038D08- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF012G03- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGNTAACCTGAGAACACCTTCAACA
JMFN044J10+ CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF022B13- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF036H22- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGANAACACCTTCAACA
rJMFF014I05- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF025D15- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
rJMFF008P09- CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
                      ____________________________________________________________
consensus CTTCCAATGTTAACAGGCTCCCGAAAGTCTGACTTTGTTAACCTGAGAACACCTTCAACA
 
. : . : . : . : . : . :
rJMFF047N21- CACTCATCGAT
rJMFF017I11- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF017A01- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMSF017E05- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMSF001N15- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMSF051L06- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF021G06- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF038D08- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF012G03- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
JMFN044J10+ CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF022B13- CACTCATCGATGAAA
rJMFF036H22- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGNCCATNTCCCCACATTTCGAATTTA
rJMFF014I05- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF025D15- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
rJMFF008P09- CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
                      ____________________________________________________________
consensus CACTCATCGATGAAAGTAAACGAACGAGTTTGAAGTCCATCTCCCCACATTTCGAATTTA
 
. : . : . : . : . : . :
rJMFF017I11- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMFF017A01- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMSF017E05- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMSF001N15- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMSF051L06- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMFF021G06- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMFF038D08- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMFF012G03- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
JMFN044J10+ TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTC
rJMFF036H22- TCNNTCGAANTTAACGCTTTTCTACAGAAANCNGCAAGAGNTTTTTCCCTTCCAC
rJMFF014I05- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMFF025D15- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
rJMFF008P09- TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
                      ____________________________________________________________
consensus TCAGTCGAAGTTAACGCTTTTCTACAGAAAGCAGCAGGAGCTTTTTCCCTTCCACCTTTC
 
. : . : . : . : . : . :
rJMFF017I11- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
rJMFF017A01- CATGTTCCAAATGGACAATAAATGNTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
rJMSF017E05- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
rJMSF001N15- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCANTACGGCATTCAATTCCAAAA
rJMSF051L06- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
rJMFF021G06- CATGTTNCAAATGGA
rJMFF038D08- CATGTTCCAA
rJMFF012G03- CATGTTCCAAATGGANCATAAATGTTGT
rJMFF014I05- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
rJMFF025D15- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
rJMFF008P09- CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
                      ____________________________________________________________
consensus CATGTTCCAAATGGACCATAAATGTTGTGGAACCTTCCAATACGGCATTCAATTCCAAAA
 
. : . : . : . : . : . :
rJMFF017I11- TCTTTGTTGTAATGCTTGCAC
rJMFF017A01- TCTTTGTTGTAATGCTTGC
rJMSF017E05- TCTTTGTTGTAATGCTTGCACAATTCCTCGG
rJMSF001N15- TCTTT
rJMFF014I05- TCTTTGNTGTAATGCTTGCACAATTCCTCGGNTGCAAGTTTCTCTAATCCAT
rJMFF025D15- TCTTTGTTGTAATGCTTGCACAATTCCTCGGNTGCAAGTTTCTCTAATCCATACGCATCT
rJMFF008P09- TCTTTGTTGTAATGCTTGCACAATTCCTCGGTTGCAAGTTTCTCTAATCCATACGCATCT
JMFF009H10+ TTGCAAGTTTCTNTAATCCATACGCATCT
JMFF047N21+ TTGCAAGTTTCTCTAATCCATACGCATCT
                      ____________________________________________________________
consensus TCTTTGTTGTAATGCTTGCACAATTCCTCGGTTGCAAGTTTCTCTAATCCATACGCATCT
 
. : . : . : . : . : . :
rJMFF025D15- TG
rJMFF008P09- TGAGGCTCAGCAGGCCATGCATCAGA
JMFF009H10+ TGAGGCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMFF047N21+ GNAGGCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTGN
JMFF017A01+ GGCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMFF038D08+ TGCTTG
JMSF051L06+ GCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMFF008P09+ GCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMFF025D15+ GCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMFF017I11+ GCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMFF036H22+ TCTAGTTGCTTG
JMFF034L11+ CTTG
JMFF014I05+ GGCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
JMSF017E05+ CTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
                      ____________________________________________________________
consensus TGAGGCTCAGCAGGCCATGCATCAGATTCCTTCAAACTCACATTAGTCTCTAGTTGCTTG
 
. : . : . : . : . : . :
JMFF009H10+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF047N21+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF017A01+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF038D08+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMSF051L06+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF008P09+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF025D15+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF017I11+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF036H22+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF034L11+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF021G06+ CCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF047A19+ TAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF014I05+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF012G03+ TAATCCTG
JMSF017E05+ AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
JMFF048I13+ CTTTTAACGCCATTAATCCTG
                      ____________________________________________________________
consensus AATTCCGGGTAAATGCAAGCACTAGAGGCATAGAAGAACCTTTTAACGCCATTAATCCTG
 
. : . : . : . : . : . :
JMFF009H10+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF047N21+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF017A01+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF038D08+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMSF051L06+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF008P09+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF025D15+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF017I11+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF036H22+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF034L11+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF021G06+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF047A19+ GAAGCTTCCATCATGTGNAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF014I05+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF012G03+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMSF017E05+ GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
JMFF048I13+ GAAGCTTCCATCATGTTGAAGCGGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
                      ____________________________________________________________
consensus GAAGCTTCCATCATGTTGAAGCTGATCATCGTGTTATTGTACATAATAACAGAGTGATTA
 
. : . : . : . : . : . :
JMFF009H10+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF047N21+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF017A01+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF038D08+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMSF051L06+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF008P09+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF025D15+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF017I11+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF036H22+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF034L11+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF021G06+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF047A19+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF014I05+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF012G03+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMSF017E05+ GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
JMFF048I13+ GACGGAAGGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
                      ____________________________________________________________
consensus GACTGAATGAACCCCATTCCACCCATATCAGCAGCAAGGTTGAAGACATGGTCAACTCCT
 
. : . : . : . : . : . :
JMFF009H10+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF047N21+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF017A01+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF038D08+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMSF051L06+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF008P09+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF025D15+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF017I11+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF036H22+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF034L11+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF021G06+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF047A19+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF014I05+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF012G03+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMSF017E05+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
JMFF048I13+ TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
                      ____________________________________________________________
consensus TGAGTGACCTTAAGACAATTGTCCATAACCCTCAGATCAGCGAGATGGAACTCATGACAG
 
. : . : . : . : . : . :
JMFF009H10+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF047N21+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF017A01+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF038D08+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMSF051L06+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF008P09+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF025D15+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF017I11+ AACATGTCCTCCGTCATGTGCTAGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF036H22+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF034L11+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF021G06+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF047A19+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF014I05+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF012G03+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMSF017E05+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
JMFF048I13+ AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
                      ____________________________________________________________
consensus AACATGTCCTCCGTCATGTGCTCGTTTTTCTTCCAGTCAGAAGCAATAACGTAGTGGCCC
 
. : . : . : . : . : . :
JMFF009H10+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF047N21+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGGG
JMFF017A01+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF038D08+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMSF051L06+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF008P09+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF025D15+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF017I11+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF036H22+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF034L11+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF021G06+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF047A19+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF014I05+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF012G03+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMSF017E05+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
JMFF048I13+ TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
                      ____________________________________________________________
consensus TCACTCTTCAGCCGGCGAGCGATGTGGGAAGCAATAAACCCTCCAGCTCCGGTAATGGAG
 
. : . : . : . : . : . :
JMFF009H10+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCC
JMFF047N21+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF017A01+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF038D08+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMSF051L06+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF008P09+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF025D15+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF017I11+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF036H22+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF034L11+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF021G06+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF047A19+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF014I05+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF012G03+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMSF017E05+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
JMFF048I13+ ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
                      ____________________________________________________________
consensus ATTCGGAGCTTCTCAGATGGCCAGTAAGGCTCCCTCTCGAGGTTCTCATAGGTGTAAGCA
 
. : . : . : . : . : . :
JMFF047N21+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF017A01+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF038D08+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMSF051L06+ CCATAA
JMFF008P09+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF025D15+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF017I11+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF036H22+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF034L11+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF021G06+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF047A19+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF014I05+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF012G03+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMSF017E05+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
JMFF048I13+ CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
                      ____________________________________________________________
consensus CCATAATCAATTCCTCCAGAACTTCCCATCCTCTAAGGTTGTAGTGTTGGCAACGAGAGA
 
. : . : . : . : . : . :
JMFF047N21+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF017A01+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATAT
JMFF038D08+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATAT
JMFF008P09+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATAT
JMFF025D15+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAAAATAT
JMFF017I11+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF036H22+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF034L11+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF021G06+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAAAATAT
JMFF047A19+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF014I05+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF012G03+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMSF017E05+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATAT
JMFF048I13+ GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATATGGGT
                      ____________________________________________________________
consensus GGCAAGGAAGAGAGGGAGAGAGAGTTGAATGGTTGAGAGTTGATAACAGAATATATGGGT