Previous Contig 002062:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007I13Sequence532002062 (14)pir|T48196|T481962e-40hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid727002062 (14)pir|T48196|T481968e-60hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFF012H19Sequence453002062 (14)pir|T48196|T481963e-28hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid738002062 (14)pir|T48196|T481968e-60hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFF023D10Sequence551002062 (14)pir|T48196|T481961e-33hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid740002062 (14)pir|T48196|T481966e-66hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFF048H22Sequence388002062 (14)gb:ATAC016795_15435872e-09Arabidopsis thaliana chromosome III BAC F26K24 genomic sequence, complete sequen551021824
JMFN006E06Sequence619002062 (14)pir|T48196|T481961e-53hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFN009E12Sequence627002062 (14)pir|T48196|T481962e-54hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFN012F20Sequence627002062 (14)pir|T48196|T481966e-59hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFN014C06Sequence627002062 (14)pir|T48196|T481966e-59hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFN015O22Sequence633002062 (14)pir|T48196|T481969e-58hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFN028N13Sequence511002062 (14)pir|T48196|T481963e-46hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid
JMFN033I06Sequence584002062 (14)pir|T48196|T481967e-49hypothetical protein T20L15.20 - Arabidopsis thaliana>gb:ATT20L15_1555028 Arabid

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF023D10- TACTGAAATTAGAAGAACATAGAAACACAGATCGATAT
                      ____________________________________________________________
consensus TACTGAAATTAGAAGAACATAGAAACACAGATCGATAT
 
. : . : . : . : . : . :
rJMFF023D10- GATGTTAAACCACAAATAATATAATCAAATAAAATTTGATTGATTCCACATCACAATTAA
                      ____________________________________________________________
consensus GATGTTAAACCACAAATAATATAATCAAATAAAATTTGATTGATTCCACATCACAATTAA
 
. : . : . : . : . : . :
rJMFF023D10- CAAGAGATTATTCATATACATGTGTGAAGTGAAGTGATATGGCTTAGTCGTCACCCGACC
JMFN015O22+ GCTTAGTCGTCACCCGACC
rJMFF012H19- ATATAGCTTAGTCGTCACCCGACC
JMFN014C06+ TCACCCGACC
JMFN012F20+ TCACCCGACC
rJMFF007I13- ATATAGCTTAGTCGTCACCCGACC
                      ____________________________________________________________
consensus CAAGAGATTATTCATATACATGTGTGAAGTGAAGTGATATAGCTTAGTCGTCACCCGACC
 
. : . : . : . : . : . :
rJMFF023D10- TGTCCTGGTTAATTTCCTCAAGAATTACAACCAATGCCACTATGAAGGCATAATCAACGT
JMFN015O22+ TGTCCTGGTTAATTTCCTCAAGAATTACAACCAAAGCCACTATGAAGGCATAA-CAACGT
JMFN009E12+ CATAATCAACGT
rJMFF012H19- TGTCCTGGTTAATTTCCTCAAGAATTACAACCAAAGCCACTATGAAGGCATAATCAACGT
JMFN014C06+ TGTCCTGGTTAATTTCCTCAAGAATTACAACCAAAGCCACTATGAAGGCATAATCAACGT
JMFN012F20+ TGTCCTGGTTAATTTCCTCAAGAATTACAACCAAAGCCACTATGAAGGCATAATCAACGT
JMFN006E06+ GCATAATCAACGT
rJMFF007I13- TGTCCTGGTTAATTTCCTCAAGAATTACAACCAAAGCCACTATGAAGGCATAATCAACGT
                      ____________________________________________________________
consensus TGTCCTGGTTAATTTCCTCAAGAATTACAACCAAAGCCACTATGAAGGCATAATCAACGT
 
. : . : . : . : . : . :
rJMFF023D10- TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCCAGAAATATACTCCCTGCCGTGTGCT
JMFN015O22+ TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
JMFN009E12+ TGGGATAAACTGTGACNCCGAAATGTTCTTTCCCTAGAAATATGCTCCGTGCCGTGTGCT
JMFN028N13+ TCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
rJMFF012H19- TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
JMFN014C06+ TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
JMFN012F20+ TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
JMFN033I06+ CTGTGACCCCGAAATGTCTTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
JMFN006E06+ TGGGATAAACTGTGACCCCGAAATG-TCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
rJMFF007I13- TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCTAGAAATATGCTCCCTGCCGTGTGTT
                      ____________________________________________________________
consensus TGGGATAAACTGTGACCCCGAAATGTTCTTTCCCTAGAAATATGCTCCCTGCCGTGTGCT
 
. : . : . : . : . : . :
rJMFF023D10- TCTTGTGCATCTGGGCAACAATGGC---GGACGACTCTCCCGCGTATATCACGCAAGATC
JMFN015O22+ TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFN009E12+ TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFN028N13+ TCTTGTGCATTTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
rJMFF012H19- TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFN014C06+ TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFN012F20+ TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFN033I06+ TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFN006E06+ TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
rJMFF007I13- TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
JMFF007I13+ TCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
                      ____________________________________________________________
consensus TCTTGTGCATCTGGGCAACAATGGCCGACGACGACTCTCCCGCGTATATCACACACGATC
 
. : . : . : . : . : . :
rJMFF023D10- GTTCCAACCAGCTCCCCTTTATATGGAAATCACACACCTCTCCTT---TGTTGCCCGCCA
JMFN015O22+ GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFN009E12+ GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFN028N13+ GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTAGTGTTGTCCGCCA
rJMFF012H19- GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFN014C06+ GTTACCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFN012F20+ GTTACCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFN033I06+ GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFN006E06+ GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
rJMFF007I13- GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFF012H19+ CTTTCGTGTTGCCCGCCA
JMFF007I13+ GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
JMFF023D10+ TGTTGCCCGCCA
                      ____________________________________________________________
consensus GTTCCCTCCAGCTCCCCATTATGTGGAAATCACACACCTCTTCTTTCGTGTTGCCCGCCA
 
. : . : . : . : . : . :
rJMFF023D10- GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGACGATTTCTTCACGCTGAACAGCA
JMFN015O22+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFN009E12+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFN028N13+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTGTTCACGCTGAACAGCA
rJMFF012H19- GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFN014C06+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFN012F20+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFN033I06+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFN006E06+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
rJMFF007I13- GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFF012H19+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFF007I13+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
JMFF023D10+ GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGACGATTTCTTCACGCTGAACAGCA
                      ____________________________________________________________
consensus GGAACACATCCAGCTTCGTCTTCAGTTGAAACAGCGATGATTTCTTCACGCTGAACAGCA
 
. : . : . : . : . : . :
rJMFF023D10- GATCTTTGGGATCCGTGCTCTCTCCCCTGAACGCTTGCCATCTTCTGTGAGCGGTGAATA
JMFN015O22+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFN009E12+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFN028N13+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATGTTCTGTGAGCGGTCAATA
rJMFF012H19- GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFN014C06+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFN012F20+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFN033I06+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFN006E06+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
rJMFF007I13- GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFF012H19+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFF007I13+ GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
JMFF023D10+ GATCTTTGGGATCCGTGCTCTCTCCCCTGAACGCTTGCCATCTTCTGTGAGCGGTGAATA
                      ____________________________________________________________
consensus GATCTTTCGGATCTGTGCTCTCTCCCCTGAACGCTTCCCATCTTCTGTGAGCGGTCAATA
 
. : . : . : . : . : . :
rJMFF023D10- TCTTTTGCTGGAAAGTGACGATGGGGTGGTCCAGGGTGTCGACCAAGACGCGGCGATCGC
JMFN015O22+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFN009E12+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFN028N13+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCTAGGGTGTCGACCAAGACGCGGCGATCGT
rJMFF012H19- TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFN014C06+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFN012F20+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFN033I06+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFN006E06+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
rJMFF007I13- TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFF012H19+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFF007I13+ TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
JMFF023D10+ TCTTTTGCTGGAAAGTGACGATGGGGTGGTCCAGGGTGTCGACCAAGACGCGGCGATCGC
JMFF048H22+ AGGGTGTCGACCAAGACGCGGGGATCGC
                      ____________________________________________________________
consensus TCTTTTGTTGGAAAGTGACGATGGGGTTGTCGAGGGTGTCGACCAAGACGCGGCGATCGT
 
. : . : . : . : . : . :
rJMFF023D10- GGAGGCTGAACAGTTT-GCTTTTCACCTTGAACATGACGGTGCCGTTGACGTCGAGGATT
JMFN015O22+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFN009E12+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFN028N13+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCAAGGATT
rJMFF012H19- GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFN014C06+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFN012F20+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFN033I06+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFN006E06+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
rJMFF007I13- GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFF012H19+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFF007I13+ GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
JMFF023D10+ GGAGGCTGAACAGTTT-GCTTTTCACCTTGAACATGACGGTGCCGTTGACGTCGAGGATT
JMFF048H22+ GGAGGCTGAACAGTTTGGCTTTTCACCTTGAACATGACGGTGCCGTTGACGTCGAGGATT
                      ____________________________________________________________
consensus GGAGGCTGAGGTGTTT-GCTTTTGATCTTGAACATGACGGTGCCGTTGAGGTCGAGGATT
 
. : . : . : . : . : . :
rJMFF023D10- TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCGCACCACCGCCAAATCCACCGGGTAG
JMFN015O22+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFN009E12+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFN028N13+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCATCAACACCGCCAAATCCATCGGGTAG
rJMFF012H19- TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFN014C06+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFN012F20+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFN033I06+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFN006E06+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
rJMFF007I13- TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFF012H19+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFF007I13+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
JMFF023D10+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCGCACCACCGCCAAATCCACCGGGTAG
JMFF048H22+ TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCGCACCACCGCCAAATCCACCGGGTAG
                      ____________________________________________________________
consensus TCGAACTTGCCTTCCTGGAGAGTCATCACCTTCCTCAACACCGCCAAATCCATCGGGTAG
 
. : . : . : . : . : . :
rJMFF023D10- GGAACGATGAACTGTGGGCTGATCACCGCCGGCACCGACACCGGCTGAG
JMFN015O22+ GGAACGATGAACTGTGGGCTGATCACCGCCGGCACGGGCACCGGCTGAGGTGGGTTCGAG
JMFN009E12+ GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFN028N13+ GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTG
rJMFF012H19- GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFN014C06+ GGAAC---GAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFN012F20+ GGAAC---GAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFN033I06+ GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFN006E06+ GGAACGATGAACTGTGGGCTGATCACCGCCGGCACGGGCACCGGCTGAGGTGGGTTCGAG
rJMFF007I13- GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGANGTGGGTTCGAG
JMFF012H19+ GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFF007I13+ GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
JMFF023D10+ GGAACGATGAACTGTGGGCTGATCACCGCCGGCACCGACACCGGCTGAGGTGGGTACGAG
JMFF048H22+ GGAACGATGAACTGTGGGCTGATCACCGCCGGCACCGACACCGGCTGAGGTGGGTACGAG
                      ____________________________________________________________
consensus GGAACGATGAACTGTGGGCTGATCACTGGCGGCACCGGCACCGGCTGAGGTGGGTTCGAG
 
. : . : . : . : . : . :
JMFN015O22+ GTGGAAACTTCGG
JMFN009E12+ GTGGAAACTTCGGTCATCATTGTGTGAAT
rJMFF012H19- GTGGAAACTTCGGTCATCATTGTGTGAAT
JMFN014C06+ GTGGAAACTTCGGTCATCATT
JMFN012F20+ GTGGAAACTTCGGTCATCATT
JMFN033I06+ GTGGAAACTTCGGTCATCATTGTGTGAATCCAAAGAGCGAGGTAGAGAGCTGAA
JMFN006E06+ GTGGAAACTTCGGTCATCATTGTGTGAATCCAA
rJMFF007I13- GTGGAAACTTCGGTCATCATTGTGTGAATCCCAAGAGCGAGGTANAGAGCTGAATTA
JMFF012H19+ GTGGAAACTTCGGTCATCATTGTGTGAAT
JMFF007I13+ GTGGAAACTTCGGTCATCATTGTGTGAATCCAAAGAGCGAGGTAGAGAGCTGAATTAGAA
JMFF023D10+ GTGGAAACTTCGGTCATCATTGTGTGAATTGAAGGA-AGATCGAGAGAGGTGAATTAGGA
JMFF048H22+ GTGGAAACTTCGGTCATCATTGTGTGAATTGAAGGA-AGATCGAGAGAGGTGAATTAGGA
                      ____________________________________________________________
consensus GTGGAAACTTCGGTCATCATTGTGTGAATCCAAAGAGCGAGGTAGAGAGCTGAATTAGGA
 
. : . : . : . : . : . :
JMFF007I13+ TT
JMFF023D10+ TTGGGAATGATGTTGCGCCAATCCTTTTTGGGAAGAATTTATATATATATAAGAAACAAG
JMFF048H22+ TTGGGAATGATGTTGCGCCAATCCTTTTTGGGAAGAATTTATATATATATAAGAAACAAG
                      ____________________________________________________________
consensus TTGGGAATGATGTTGCGCCAATCCTTTTTGGGAAGAATTTATATATATATAAGAAACAAG
 
. : . : . : . : . : . :
JMFF023D10+ GGGGGTGATTATTTAACGTTGTTAACTTAACCGCGTTGAATTGGCAGGCGGGAACCGGC
JMFF048H22+ GGGGGTGATTATTTAACGTTGTTAACTTAACCGCGTTGAATTGGCAGGCGGGAACCGGCC
                      ____________________________________________________________
consensus GGGGGTGATTATTTAACGTTGTTAACTTAACCGCGTTGAATTGGCAGGCGGGAACCGGCC