Previous Contig 002058:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028J04Sequence557002058 (9)gb:BT006140_16390348e-25Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR749002058 (9)gb:BT006140_16390343e-20Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR
JMFF031K03Sequence615002058 (9)gb:BT006140_16390341e-24Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR762002058 (9)gb:BT006140_16390341e-24Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR
JMFF048E04Sequence482002058 (9)gb:BT006140_16390342e-19Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR319002058 (9)
JMSF040H18Sequence365002058 (9)gb:AJ633998_18130841e-11Cicer arietinum mRNA for LIN1 protein.854023899
JMSF050G19Sequence706002058 (9)gb:BT006140_16390341e-24Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR756002058 (9)gb:BT006140_16390341e-24Arabidopsis thaliana clone RAFL21-16-K04 (R51285) unknown protein (At3g13885) mR

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048E04- ACCCTGGAGAGTTTTTTTTTTTTTTTGGAAAATATTTCTGTTTATTCTA
rJMFF028J04- TTCTA
rJMFF031K03- TGTTT-TTCTA
                      ____________________________________________________________
consensus ACCCTGGAGAGTTTTTTTTTTTTTTTGGAAAATATTTCTGTTTATTCTA
 
. : . : . : . : . : . :
rJMFF048E04- CCAACTTATAACAGTTTCTGATTTTGCATCATGCATACATCAAGATGAAAAAGGGTGAAA
rJMFF028J04- CCAACTTATAACAGTTTCTGATTTTGCATCATGCATACATCAAGATGAAAAAGGGTGAAA
rJMFF031K03- CCAACTTATAACAGTTTCTGATTTTGCATCATGCATACATCAAGATGAAAAAGGGTGAAA
rJMSF050G19- GTTTCTGATTTTGCATCATGCATACATCAAGATGAAAAAGGGTGAAA
                      ____________________________________________________________
consensus CCAACTTATAACAGTTTCTGATTTTGCATCATGCATACATCAAGATGAAAAAGGGTGAAA
 
. : . : . : . : . : . :
rJMFF048E04- AGTCACTGCCATGGCAAAAGAAATACCACCTATCACATAAAAATTACTACAGTTCAAGAA
rJMFF028J04- AGTCACTGCCATGGCAAAAGAAATACCACCTATCACATAAAAATTACTACAGTTCAAGAA
rJMFF031K03- AGTCACTGCCATGGCAAAAGAAATACCACCTATCACATAAAAATTACTACAGTTCAAGAA
rJMSF050G19- AGTCACTGCCATGGCAAAAGAAATACCACCTATCACATAAAAATTACTACAGTTCAAGAA
JMSF050G19+ GGCAAAAGAAATACCACCTATCACATAAAAATTACTACAGTTCAAGAA
                      ____________________________________________________________
consensus AGTCACTGCCATGGCAAAAGAAATACCACCTATCACATAAAAATTACTACAGTTCAAGAA
 
. : . : . : . : . : . :
rJMFF048E04- TTTTGAGCAGCAACATGAAATCCATAAGATTATGAGATGAACAAGGCAAAGACTAATGAT
rJMFF028J04- TTTTGAGCAGCAACATGAAATCCATAAGATTATGAGATGAACAAGGCAAAGACTAATGAT
rJMFF031K03- TTTTGAGCAGCAACATGAAATCCATAAGATTATGAGATGAACAAGGCAAAGACTAATGAT
rJMSF050G19- TTTTGAGCAGCAACATGAAATCCATAAGATTATGAGATGAACAAGGCAAAGACTAATGAT
JMFF031K03+ AAGGCAAAGACTAATGAT
JMSF050G19+ TTTTGAGCAGCAACATGAAATCCATAAGATTATGAGATGAACAAGGCAAAGACTAATGAT
                      ____________________________________________________________
consensus TTTTGAGCAGCAACATGAAATCCATAAGATTATGAGATGAACAAGGCAAAGACTAATGAT
 
. : . : . : . : . : . :
rJMFF048E04- TAAATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
rJMFF028J04- TAGATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
rJMFF031K03- TAGATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
rJMSF050G19- TAGATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
JMFF031K03+ TAGATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
JMFF028J04+ TGGGCTCGATATTGCACTAT
JMSF050G19+ TAGATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
                      ____________________________________________________________
consensus TAGATGCAAGCAGAAACAGGGCAGTGTCTTGGGTGTCGCCTGGGCTCGATATTGCACTAT
 
. : . : . : . : . : . :
rJMFF048E04- ATCAACCTTCTAGTGACCTTAATTGGATCC
rJMFF028J04- ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
rJMFF031K03- ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
rJMSF050G19- ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
JMFF031K03+ ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
JMFF028J04+ ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
JMSF050G19+ ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
JMFF048E04+ TA
                      ____________________________________________________________
consensus ATCAACCTTCTAGTGACCTTAATTGGATCCACAGTTGCAATATGGTGTATTGTTTATGTA
 
. : . : . : . : . : . :
rJMFF028J04- GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
rJMFF031K03- GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
rJMSF050G19- GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
JMFF031K03+ GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
JMFF028J04+ GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
JMSF050G19+ GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
JMFF048E04+ GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
                      ____________________________________________________________
consensus GCTATACTGCTATTCGTGCACGTCCCTTGGCAATTCTCCGAGCAATAACTCTTCGGCCAC
 
. : . : . : . : . : . :
rJMFF028J04- CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
rJMFF031K03- CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
rJMSF050G19- CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
JMFF031K03+ CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
JMFF028J04+ CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
JMSF050G19+ CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
JMFF048E04+ CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
                      ____________________________________________________________
consensus CCACTGTAGCTTTGCGGGCACGAAATCCATGATTCCTTTTACGCCTGATGTTACTTGGTT
 
. : . : . : . : . : . :
rJMFF028J04- GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
rJMFF031K03- GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
rJMSF050G19- GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
JMFF031K03+ GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
JMFF028J04+ GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
JMSF050G19+ GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
JMFF048E04+ GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
                      ____________________________________________________________
consensus GGTACGTTCTCTTAGTGTGACAAAGAAGTGGTTCACTTGAAGAAGTTTCTCCTGGTGTCA
 
. : . : . : . : . : . :
rJMFF028J04- CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
rJMFF031K03- CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
rJMSF050G19- CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
JMFF031K03+ CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
JMFF028J04+ CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
JMSF050G19+ CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
JMSF040H18+ CCTCGGGAAGGAAGAAGCGGAGNGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
JMFF048E04+ CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
                      ____________________________________________________________
consensus CCTCGGGAAGGAAGAAGCGGAGAGAAGGGAGGCCACAGGGGTACAGAAAACCCTCCGATG
 
. : . : . : . : . : . :
rJMFF028J04- AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
rJMFF031K03- AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
rJMSF050G19- AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
JMFF031K03+ AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
JMFF028J04+ AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
JMSF050G19+ AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
JMSF040H18+ AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
JMFF048E04+ AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAACTTAAGCTGAGCCTGAGACTCAG
                      ____________________________________________________________
consensus AGAGCTTTCGGCACAAATCCGCATTGCTTTCGGGCAAATTAAGTGGAGCCTGAGACTCAG
 
. : . : . : . : . : . :
rJMFF028J04- AGGGATATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
rJMFF031K03- AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
rJMSF050G19- AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
JMFF031K03+ AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
JMFF028J04+ AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
JMSF050G19+ AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
JMSF040H18+ AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
JMFF048E04+ AGGACTATGGACTGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
                      ____________________________________________________________
consensus AGGA-TATGGA-AGGGAAGAGCTTCGGAGTGATCTCCGGAGTCTGAGAAACCAATTGCTG
 
. : . : . : . : . : . :
rJMFF028J04- TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
rJMFF031K03- TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
rJMSF050G19- TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
JMFF031K03+ TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
JMFF028J04+ TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
JMSF050G19+ TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
JMSF040H18+ TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
JMFF048E04+ TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
                      ____________________________________________________________
consensus TGTATTTCGTGTCGAATTTTGGCTCATCAACCGAGTCATCAAAGAGAAGCTAGTTCGAAT
 
. : . : . : . : . : . :
rJMFF028J04- GAGAGTTCTCGACGAC
rJMFF031K03- GAGAGTTCTCGACGACGANGACGCCATTGT
rJMSF050G19- GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAG
JMFF031K03+ GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAGTAAACCCT
JMFF028J04+ GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAGTAAGCCCT
JMSF050G19+ GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAGTAAACCCT
JMSF040H18+ GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAGTAAACCCT
JMFF048E04+ GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAGTAAGCCCTC
                      ____________________________________________________________
consensus GAGAGTTCTCGACGACGAGGACGCCATTGTTTCCCTCAGCAGGAATTTCAGTAAACCCTC