Previous Contig 002057:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048E02Sequence376002057 (4)sp|Q9SZA7|DR29_ARATH6e-16Probable disease resistance protein At4g33300.>pir|T05981|T05981 hypothetical pr337010805 (4)sp|Q9SZA7|DR29_ARATH0.008Probable disease resistance protein At4g33300.>pir|T05981|T05981 hypothetical pr
JMFS017B07Sequence623002057 (4)sp|Q9SZA7|DR29_ARATH8e-38Probable disease resistance protein At4g33300.>pir|T05981|T05981 hypothetical pr
JMFS086F03Sequence606002057 (4)sp|Q9SZA7|DR29_ARATH2e-39Probable disease resistance protein At4g33300.>pir|T05981|T05981 hypothetical pr
JMFS146B02Sequence627002057 (4)sp|Q9SZA7|DR29_ARATH2e-38Probable disease resistance protein At4g33300.>pir|T05981|T05981 hypothetical pr

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS086F03+ GAGCAGGCATCCTGTTCCAATCGAATTGCGGGTTCCACCCAGG
                      ____________________________________________________________
consensus GAGCAGGCATCCTGTTCCAATCGAATTGCGGGTTCCACCCAGG
 
. : . : . : . : . : . :
JMFS086F03+ AAACATATTGGCAGAAGATTGAAGAGTACACCCTGATATCATTGACCAAACCTGTAACCT
                      ____________________________________________________________
consensus AAACATATTGGCAGAAGATTGAAGAGTACACCCTGATATCATTGACCAAACCTGTAACCT
 
. : . : . : . : . : . :
JMFS086F03+ CAAATGCTCCACATTTGGAGATTGAGACACAGTAAGAAAGTGAACCCTTCCCTTGAAAAA
                      ____________________________________________________________
consensus CAAATGCTCCACATTTGGAGATTGAGACACAGTAAGAAAGTGAACCCTTCCCTTGAAAAA
 
. : . : . : . : . : . :
JMFS086F03+ ACTTTGAATTTCATCATCTTTGCTAATCTCTCTGGCTAAAGTGGTTTTCCCACTGCCTCC
                      ____________________________________________________________
consensus ACTTTGAATTTCATCATCTTTGCTAATCTCTCTGGCTAAAGTGGTTTTCCCACTGCCTCC
 
. : . : . : . : . : . :
JMFS086F03+ AATCCCACAAAGTTCAAAAACGCCACTGTTTTCTTCATCCTTCATTAACATATCTTTCAC
                      ____________________________________________________________
consensus AATCCCACAAAGTTCAAAAACGCCACTGTTTTCTTCATCCTTCATTAACATATCTTTCAC
 
. : . : . : . : . : . :
JMFS086F03+ TTTCCTCTTCCCCAATTCAAACCCGGCACCCAGATTTACAAAACTGTCCTCGCACCACCT
JMFS146B02+ CGGCACCCAGATTTACAAAACTGTCCTCGCACCACCT
JMFS017B07+ CGGCACCCAGATTTACAAAACTGTCCTCGCACCACCT
                      ____________________________________________________________
consensus TTTCCTCTTCCCCAATTCAAACCCGGCACCCAGATTTACAAAACTGTCCTCGCACCACCT
 
. : . : . : . : . : . :
JMFS086F03+ CTGCTCCTCCGCCACCCTCTTCACGGCCTCCCCCAACCACCCGCCGCCGCCGCCGCCCTC
JMFS146B02+ TTGCTCCTCCGCCACCCTCTTCACGGCCTCCCCCAACCACCCGCCGCCGCCGCCGCCCTC
JMFS017B07+ NTGCTCCTCCGCCACCCTNTTCACGGCCTCCCCCAACCACCCGCCGCCGCCGCCGCCCTC
                      ____________________________________________________________
consensus TTGCTCCTCCGCCACCCTCTTCACGGCCTCCCCCAACCACCCGCCGCCGCCGCCGCCCTC
 
. : . : . : . : . : . :
JMFS086F03+ GTCCACGCCGATTTTCATGGCGCCAAGCTGCTGCTCGATCCGCTTGAACGAATTGTCCAG
JMFS146B02+ GTCCACGCCGATTTTCATGGCGCCAAGCTGCTGCTCGATCCGCTTGAACGAATTGTCCAG
JMFS017B07+ GTCCACGCCGATTTTCATGGCGCCAAGCTGCTGCTCGATCCGCTTGAACGAATTGTCCAG
                      ____________________________________________________________
consensus GTCCACGCCGATTTTCATGGCGCCAAGCTGCTGCTCGATCCGCTTGAACGAATTGTCCAG
 
. : . : . : . : . : . :
JMFS086F03+ CCGATCGAACCTCTGCTCCGTGTCGACCCTCACGTGATGGACGTCGGCCATCACGTGCGC
JMFS146B02+ CCGATCGAACCTCTGCTCCGTGTCGACCCTCACGTGATGGACGTCGGCCATCACGTGCGC
JMFS017B07+ CCGATCGAACCTCTGCTCCGTGTCGACCCTCACGTGATGGACGTCGGCCATCACGTGCGC
                      ____________________________________________________________
consensus CCGATCGAACCTCTGCTCCGTGTCGACCCTCACGTGATGGACGTCGGCCATCACGTGCGC
 
. : . : . : . : . : . :
JMFS086F03+ CGGCATGATCCCCTGCACGAACCTGGAGACCCTCTTCTCCAGCTTCTCCATTTTTCGGGC
JMFS146B02+ CGGCATGATCCCCTGCACGAACCTGGAGACCCTCTTCTCCAGCTTCTCCATTTTTCGGGC
JMFS017B07+ CGGCATGATCCCCTGCACGAACCTGGAGACCCTCTTCTCCAGCTTCTCCATTTTTCGGGC
JMFF048E02+ TCTCCATTTTTCGGGC
                      ____________________________________________________________
consensus CGGCATGATCCCCTGCACGAACCTGGAGACCCTCTTCTCCAGCTTCTCCATTTTTCGGGC
 
. : . : . : . : . : . :
JMFS086F03+ GAACTGGAGATTCTTGTACATGT
JMFS146B02+ GAACTGGAGATTCTTGTACATGTTCCAGCGCCCACACTTGAGGACCTTGTCGGCGAGCTC
JMFS017B07+ GAACTGGAGATTCTTGTACATGTTCCAGCGCCCACACTTGAGGACCTTGTCGGCGAGCTC
JMFF048E02+ GAACTGGAGATTCTTGTACATGTTCCAGCGCCCACACTTGAGGACCTTGTCGGCGAGCTC
                      ____________________________________________________________
consensus GAACTGGAGATTCTTGTACATGTTCCAGCGCCCACACTTGAGGACCTTGTCGGCGAGCTC
 
. : . : . : . : . : . :
JMFS146B02+ GACGCCGGCGGAGAGAGTCCTGGAGAACTCGTCGAGCTGGCGCTGGCGCTCCTGCGGCAG
JMFS017B07+ GACGCCGGCGGAGAGAGTCCTGGAGAACTCGTCGAGCTGGCGCTGGCGCTCCTGCGGCAG
JMFF048E02+ GACGCCGGCGGAGAGAGTCCTGGAGAACTCGTCGAGCTGGCGCTGGCGCTCCTGCGGCAG
                      ____________________________________________________________
consensus GACGCCGGCGGAGAGAGTCCTGGAGAACTCGTCGAGCTGGCGCTGGCGCTCCTGCGGCAG
 
. : . : . : . : . : . :
JMFS146B02+ CTCGACGCCGGTGGCCTTGATTTCCCTGATAATTGGGTCGA-CCGCACTGATGTCTTCAA
JMFS017B07+ CTCGACGCCGGTGGCCTTGATTTCCCTGATAATTGGGTCGA-CCGCACTGATGTCTTCAA
JMFF048E02+ CTCGACGCCGGTGGCCTTGATTTCCCTGATAATTGGGTCGACCCTCACTGATGTCTTCAA
                      ____________________________________________________________
consensus CTCGACGCCGGTGGCCTTGATTTCCCTGATAATTGGGTCGA-CCGCACTGATGTCTTCAA
 
. : . : . : . : . : . :
JMFS146B02+ TTAGCTGCAAAGCGCTGTTGCGGGAGAGGGCGCACTTCTTGCAGATAGCGTAGAGATTTT
JMFS017B07+ TTAGCTGCAAAGCGCTGTTGCGGGAGAGGGCGCACTTCTTGCAGATAGCGTAGAGATTTT
JMFF048E02+ TTAGCTGCAAATCGCTGTTGCGGGAGAGGGCGCACTTCTTGCAGATAGCGTAGAGATTTT
                      ____________________________________________________________
consensus TTAGCTGCAAAGCGCTGTTGCGGGAGAGGGCGCACTTCTTGCAGATAGCGTAGAGATTTT
 
. : . : . : . : . : . :
JMFS146B02+ TGAGGAGCTCGGTAGCGATTTCTCCGGCGAAAAGATCCGTCACCGCCATTGTTGTTTGTA
JMFS017B07+ TGAGGAGCTCGGTAGCGATTTCTCCGGCGAAAAGATCCGTCACCGCCATTGTTGTTTGTA
JMFF048E02+ TGAGGAGCTCGGTAGCGATTTCTCCGGCGAAAAGATCCGTCACCGCCATTGTTGTTTGTA
                      ____________________________________________________________
consensus TGAGGAGCTCGGTAGCGATTTCTCCGGCGAAAAGATCCGTCACCGCCATTGTTGTTTGTA
 
. : . : . : . : . : . :
JMFS146B02+ ATGGTGGTGCCTAAGCTTTTCTCAGCTCCGTGGTGAGAACTTCG
JMFS017B07+ ATGGTGGTGCCTAAGCTTTTCTCAGCTCCGTGGTGAGAACTTCG
JMFF048E02+ ATGGTGGTGCCTAAGCTTTTCTCAGCTCCGTGGTGAGAACTTCGCGGAAGTGGTGGAAGT
                      ____________________________________________________________
consensus ATGGTGGTGCCTAAGCTTTTCTCAGCTCCGTGGTGAGAACTTCGCGGAAGTGGTGGAAGT