Previous Contig 002055:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF048D08Sequence422002055 (4)gb:BT014755_16417459e-29Arabidopsis thaliana At5g26800 gene, complete cds.>gb:BT014996_1641966 Arabidops497002055 (4)gb:BT014755_16417454e-04Arabidopsis thaliana At5g26800 gene, complete cds.>gb:BT014996_1641966 Arabidops
JMFF048F06Sequence412002055 (4)gb:BT014755_16417452e-29Arabidopsis thaliana At5g26800 gene, complete cds.>gb:BT014996_1641966 Arabidops
JMFN043A19Sequence599002055 (4)gb:BT014755_16417451e-22Arabidopsis thaliana At5g26800 gene, complete cds.>gb:BT014996_1641966 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048D08- AAAAAAAAAAACTGTTTCTGGGGTTTAAACCAAAAGTGACAATT
JMFN043A19+ ACCAAAAGTGACAATT
                      ____________________________________________________________
consensus AAAAAAAAAAACTGTTTCTGGGGTTTAAACCAAAAGTGACAATT
 
. : . : . : . : . : . :
rJMFF048D08- CTTGAAAAACCAAAATCCCAAGTAAAGCCAAAGCATGATGTCCAAAAGGGCATGCTTTCC
JMFN043A19+ CATGAAAAACCAGAATCACAAGTAAAGCCAAAGCATGATGTCCAATAGTGCATGCTTTCC
                      ____________________________________________________________
consensus CTTGAAAAACCAGAATCCCAAGTAAAGCCAAAGCATGATGTCCAATAGTGCATGCTTTCC
 
. : . : . : . : . : . :
rJMFF048D08- TTATCCAAATTTACTAAACAAAAGGGCTAAACTCCCTGAAAAACTTAAGCTCTTACTCCA
JMFN043A19+ TTATCCAGATTTACTAAACAAAAGGTCTAGACTCCCTGAATAACTTAAGCTCTTACTCGA
                      ____________________________________________________________
consensus TTATCCAGATTTACTAAACAAAAGGTCTAGACTCCCTGAATAACTTAAGCTCTTACTCGA
 
. : . : . : . : . : . :
rJMFF048D08- GCTCACAGGCGTAAATTTTACAAAGGGCATTCTTCAAAAAAATTTATGTTTGGGGGGGCC
JMFN043A19+ GCTCAGAGCAGTAAATATTACAAAGCGCATTCGTCAAATAAACTTATGTGTGGGGTGGCA
                      ____________________________________________________________
consensus GCTCAGAGGCGTAAATTTTACAAAGGGCATTCTTCAAATAAATTTATGTTTGGGGTGGCC
 
. : . : . : . : . : . :
rJMFF048D08- AGTTATCAAAAGCGTTGTTAGGATTTCCCAGGCTCCGCTCTAGGCCTCCA
JMFN043A19+ AGTTATCGAAAGCGTTGTTAGGATTTCACAGGCTCCGCTCTAGGCCTCCATAGTCCCAGT
JMFF048F06+ AAAGCGTTGTTAGGATTTCACAGGCTCCGCTCTAGGCCTCCATAGTCCCAGT
JMFF048D08+ AGTTATCGAAAGCGTTGTTAGGATTTCACAGGCTCCGCTTTAGGCCTCCATAGTCCCAGT
                      ____________________________________________________________
consensus AGTTATCGAAAGCGTTGTTAGGATTTCACAGGCTCCGCTCTAGGCCTCCATAGTCCCAGT
 
. : . : . : . : . : . :
JMFN043A19+ CTATATTTGTGGGTGTATTTCAGTATTAGTTTCCTATGCTTTACGGGGATGCCAAGACGC
JMFF048F06+ CTATATTTGTGGGTGTATTTCAGTATTAGTTTCCTATGCTTTACGGGGATGCCAAGACGC
JMFF048D08+ CTATATTTGTGGGTGTATTTCAGTATTAGTTTCCTATGCTTTACGGGGATGCCAAGACGC
                      ____________________________________________________________
consensus CTATATTTGTGGGTGTATTTCAGTATTAGTTTCCTATGCTTTACGGGGATGCCAAGACGC
 
. : . : . : . : . : . :
JMFN043A19+ TTGAGCCTAAGGGTTCGAGTAACCAGAAGCTTCTGGAAATCTCCGATCTCGGACTCAATC
JMFF048F06+ TTGAGCCCAAGGGTTCGAGTAACCAGAAGCTTCTGGAAATCTCCGATCTCGGACTCAATC
JMFF048D08+ TTGAGCCCAAGGGTTCGAGTAACCAGAAGCTTCTGGAAATCTCCGATCTCGGACTCAATC
                      ____________________________________________________________
consensus TTGAGCCCAAGGGTTCGAGTAACCAGAAGCTTCTGGAAATCTCCGATCTCGGACTCAATC
 
. : . : . : . : . : . :
JMFN043A19+ TTTTCGGCATGGGTCTCTACCCCTTTCCCCACTCCGTTCAAGAACTCTGGAATCCCCACC
JMFF048F06+ TTTTCGGCATGGGTCTCTACCCCTTTCCCCACTCCGTTCAAGAACTCTGGAATCCCCACC
JMFF048D08+ TTTTCGGCATGGGTCTCTACCCCTTTCCCCACTCCGTTCAAGAACTCTGGAATCCCCACC
                      ____________________________________________________________
consensus TTTTCGGCATGGGTCTCTACCCCTTTCCCCACTCCGTTCAAGAACTCTGGAATCCCCACC
 
. : . : . : . : . : . :
JMFN043A19+ TTCACTATGTACTGATTGGATTTGGAGGAGAAACTAGAAAACCCTGCGAAGGGTGACAGT
JMFF048F06+ TTCACTATGTACTGATTGGATTTGGAGGAGAAACTAGAAAACCCTGCGAAGGGTGACAGT
JMFF048D08+ TTCACTATGTACTGATTGGATTTGGAGGAGAAACTAGAAAACCCTGCGAAGGGTGACAGT
                      ____________________________________________________________
consensus TTCACTATGTACTGATTGGATTTGGAGGAGAAACTAGAAAACCCTGCGAAGGGTGACAGT
 
. : . : . : . : . : . :
JMFN043A19+ GCAGCATTTGATGGTATAGGAAATCTTCTGTTGAGGGAAAAGAATTGCCTCCACGCCATG
JMFF048F06+ GCAGCATTTGATGGTATAGGAAATCTTCTGTTGAGGGAAAAGAATTGCCTCCACGCCATG
JMFF048D08+ GCAGCATTTGATGGTATAGGAAATCTTCTGTTGAGGGAAAAGAATGTCCTCCACGCCATG
                      ____________________________________________________________
consensus GCAGCATTTGATGGTATAGGAAATCTTCTGTTGAGGGAAAAGAATTGCCTCCACGCCATG
 
. : . : . : . : . : . :
JMFN043A19+ GGAAGAAACTTCAATCTCTGTTCAGCACTCCTCTAGGTTT
JMFF048F06+ GGAAGAAACTTCAATCTCTTTTCAGCACTCCTCTAGGTTTTAACTTCAAAACCCTCCTAC
JMFF048D08+ GGAAGAAACTTCAATCTCTTTTCAGCACTCCTCTAGGTTTTAACTTCAAAACCCTCCTAC
                      ____________________________________________________________
consensus GGAAGAAACTTCAATCTCTTTTCAGCACTCCTCTAGGTTTTAACTTCAAAACCCTCCTAC