Previous Contig 002046:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017F20Sequence525002046 (12)gb:AC012562_15377215e-04Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence642002046 (12)gb:AC012562_15377211e-50Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence
JMFF048A24Sequence341002046 (12)251002046 (12)
JMFF050M08Sequence583002046 (12)gb:AC012562_15377218e-18Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence574002046 (12)gb:AC012562_15377216e-39Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence
JMFS048H05Sequence522002046 (12)gb:AC012562_15377212e-22Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence
JMSF016E15Sequence466002046 (12)gb:AC012562_15377219e-05Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence697002046 (12)gb:AC012562_15377212e-69Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence
JMSF017I02Sequence456002046 (12)gb:AC012562_15377215e-06Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence673002046 (12)gb:AC012562_15377213e-63Arabidopsis thaliana chromosome 3 BAC F17O14 genomic sequence, complete sequence
JMSF032H21Sequence488002046 (12)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048A24- ATCAGAAAGGGTTAAACTAGTTGTCCCTTGAAAGCAACAGAATTTGTTTCCATTTTATT
rJMFF050M08- TTGAAAGCAACAGAATTTGTTTCCATTTTATT
rJMFF017F20- TTTGTTTCCATCTTATT
                      ____________________________________________________________
consensus ATCAGAAAGGGTTAAACTAGTTGTCCCTTGAAAGCAACAGAATTTGTTTCCATTTTATT
 
. : . : . : . : . : . :
rJMFF048A24- CAGAGCTCANAGGATAAGAAAGAGGAAAACAAACTA-GACCATATAGCTTACAACCCAAA
rJMFF050M08- CAGAGCTCAAAGGATAAGAAAGAGGAAAACAAACTA-GACAATATAGCTTACAACCCAAA
rJMFF017F20- CTGAGCTCNAAGGATAAGAAAGAGGAAAACAAACTANGACAATATAGCTTACAACCCAAA
rJMSF017I02- TAAGAAAGAGGAAAACAAACTA-GACAATATAGCTTACAACCCAAA
rJMSF016E15- AAGAGGAAAACAAACTA-GACAATATAGCTTACAACCCAAA
                      ____________________________________________________________
consensus CAGAGCTCAAAGGATAAGAAAGAGGAAAACAAACTA-GACAATATAGCTTACAACCCAAA
 
. : . : . : . : . : . :
rJMFF048A24- TCACTTAGAGACAGCAGACTCATTCTGCAAATTCTCACTTTGATTCA-CAACTTCACTCT
rJMFF050M08- TCACTTAGAGACAGCAGACTCATTCTGCAAATTCTCACTTTGATTCACCAACTTCACTCT
rJMFF017F20- TCACTTAGAGACAGCAGACTCATTCTGCAAATTCTCACTTTGATTCACCAACTTCACTCT
rJMSF017I02- TCACTTAGAGACAGCAGACTCATTCTGCAAATTCTCACTTTGATTCACCAACTTCACTCT
rJMSF016E15- TCACTTAGAGACAGCAGACTCATTCTGCAAATTCTCACTTTGATTCACCAACTTCACTCT
                      ____________________________________________________________
consensus TCACTTAGAGACAGCAGACTCATTCTGCAAATTCTCACTTTGATTCACCAACTTCACTCT
 
. : . : . : . : . : . :
rJMFF048A24- TTCTGCAGCCAATTCATCTTCTTCTACTGCAGCTACGCTCTGAGCGCCTGTCATTCTTGC
rJMFF050M08- TTCTGCAGCCAATTCATCTTCTTCTACTGCAGCTACGCTCTGAGCGCCTGTCATTCTTGC
rJMFF017F20- TTCTGCAGCCAATTCATCTTCTTCTACTGCAGCTACGCTCTGAGCGCCTGTCATTCTTGC
rJMSF017I02- TTCTGCAGCCAATTCATCTTCTTCTACTGCAGCTACGCTCTGAGCGCCTGTCATTCTTGC
rJMSF016E15- TTCTGCAGCCAATTCATCTTCTTCTACTGCAGCTACGCTCTGAGCGCCTGTCATTCTTGC
                      ____________________________________________________________
consensus TTCTGCAGCCAATTCATCTTCTTCTACTGCAGCTACGCTCTGAGCGCCTGTCATTCTTGC
 
. : . : . : . : . : . :
rJMFF048A24- CAACACCACGAACG
rJMFF050M08- CAACACCACGAACGACACTCCCCCGAGGACATTATTCAGGCATCGCAACACGATAACCGA
rJMFF017F20- CAACACCACGAACGACACTCCCCCGAGGACATTATTCAGGCATCNCAACACGATAACCGA
rJMSF017I02- CAACACCACGAACGACACTCCCCCGAGGACATTATTCAGGCATCGCAACACGATAACCGA
rJMSF016E15- CAACACCACGAACGACACTCCCCCGAGGACATTATTCAGGCATCGCAACACGATAACCGA
                      ____________________________________________________________
consensus CAACACCACGAACGACACTCCCCCGAGGACATTATTCAGGCATCGCAACACGATAACCGA
 
. : . : . : . : . : . :
rJMFF050M08- GCTCTTGAACACGAAGGGAGAAACCGTCTTGTCCAGCAAGAACTCGATCCCGTTCAGCGT
rJMFF017F20- GCTCTTGAACACGAAGGGAGAAACCGNCTTGTCCAGCAAGAACTCGATCCCGTTCAGCGT
rJMSF017I02- GCTCTTGAACACGAAGGGAGAAACCGTCTTGTCCAGCAAGAACTCGATCCCGTTCAGCGT
rJMSF016E15- GCTCTTGAACACGAAGGGAGAAACCGTCTTGTCCAGCAAGAACTCGATCCCGTTCAGCGT
                      ____________________________________________________________
consensus GCTCTTGAACACGAAGGGAGAAACCGTCTTGTCCAGCAAGAACTCGATCCCGTTCAGCGT
 
. : . : . : . : . : . :
rJMFF050M08- TTGGTAGCGCAGATTACTGCTAACACCCATGTGGATTGCCCAGGTAGCTGCATTCAGGAT
rJMFF017F20- TTGGTAGCGCAGATTACTGCTAACACCCATGTGGATTGCCCAGGTAGCTGCATTCAGGAT
rJMSF017I02- TTGGTAGCGCAGATTACTGCTAACACCCATGTGGATTGCCCAGGTAGCTGCATTCAGGAT
rJMSF016E15- TTGGTAGCGCAGATTACTGCTAACACCCATGTGGATTGCCCAGGTAGCTGCATTCAGGAT
                      ____________________________________________________________
consensus TTGGTAGCGCAGATTACTGCTAACACCCATGTGGATTGCCCAGGTAGCTGCATTCAGGAT
 
. : . : . : . : . : . :
rJMFF050M08- GGTGGGTGGAGCCTTGTTTGGTGTTTCGAAACTTGGATCCATCTTCTTCCTGATCTTGAT
rJMFF017F20- GGTGGGTGGAGCCTTGTTTGGTGTTTCGAAACTTGGATCCATCTTCTTCCTGATCTTGAT
rJMSF017I02- GGTGGGTGGAGCCTTGTTTGGTGTTTCGAAACTTGGATCCATCTTCTTCCTGATCTTGAT
rJMSF016E15- GGTGGGTGGAGCCTTGTTTGGTGTTTCGAAACTTGGATCCATCTTCTTCCTGATCTTGAT
                      ____________________________________________________________
consensus GGTGGGTGGAGCCTTGTTTGGTGTTTCGAAACTTGGATCCATCTTCTTCCTGATCTTGAT
 
. : . : . : . : . : . :
rJMFF050M08- CAGTCCATTCGAGAGGGCGGTTCCCACCAGCCCTGCGGCGAATCCAACCGCAGCAAACAG
rJMFF017F20- CAGTCCATTCGAGAGGGCGGTTCCCACCAGCCCTGCGGCGAATCCAACCGCAGCAAACAG
rJMSF017I02- CAGTCCATTCGAGAGGGCGGTTCCCACCAGCCCTGCGGCGAATCCAACCGCAGCAAACAG
rJMSF016E15- CAGTCCATTCGAGAGGGCGGTTCCCACCAGCCCTGCGGCGAATCCAACCGCAGCAAACAG
                      ____________________________________________________________
consensus CAGTCCATTCGAGAGGGCGGTTCCCACCAGCCCTGCGGCGAATCCAACCGCAGCAAACAG
 
. : . : . : . : . : . :
rJMFF050M08- AGTGCCCTTGTACACGAAAGTGCCAAGCCTGCTGATCAGACCGTAAGGA
rJMFF017F20- AGTGCCCTTGTACACGAAAGTGCCAAGCCTGCTGATCAGACCGTAAGGACCGGGCTCAAA
rJMSF017I02- AGTGCCCTTGTACACGAAAGTGCCAAGCCTGCTGATCAGACCGTAAGGACCGGGCTCAAA
rJMSF016E15- AGTGCCCTTGTACACGAAAGTGCCAAGCCTGCTGATCAGACCGTAAGGACCGGGCTCAAA
                      ____________________________________________________________
consensus AGTGCCCTTGTACACGAAAGTGCCAAGCCTGCTGATCAGACCGTAAGGACCGGGCTCAAA
 
. : . : . : . : . : . :
rJMFF017F20- CATGTGGCTTGTGGGACAGCTCGCGAAAATGGAAGGTAAACCCTGGCTTACAGAGGAAGC
rJMSF017I02- CATGTGGCTTGTGGGACAGCTCGCGAAAATGGAAGGTAAACCCTGGCTTACAGAGGAAGC
rJMSF016E15- CATGTGGCTTGTGGGACAGCTCGCGAAAATGGAAGGTAAACCCTGGCTTACAGAGGAAGC
                      ____________________________________________________________
consensus CATGTGGCTTGTGGGACAGCTCGCGAAAATGGAAGGTAAACCCTGGCTTACAGAGGAAGC
 
. : . : . : . : . : . :
rJMFF017F20- GGTTGGCGCCAAGAGATACATGAGC
rJMSF017I02- GGTTGGCGCCAAGAGATACATGAGCACGAAGTTCAAAATGGAGCCGACGACCAGAGTCGA
rJMSF016E15- GGTTGGCGCCAAGAGATACATGAGCACGAAGTTCAAAATGGAGCCGACGACCAGAGTCGA
JMFS048H05+ GACGACCAGAGTCGA
                      ____________________________________________________________
consensus GGTTGGCGCCAAGAGATACATGAGCACGAAGTTCAAAATGGAGCCGACGACCAGAGTCGA
 
. : . : . : . : . : . :
rJMSF017I02- GAAGACGAAATCGAGCTCGTTGAGGCCG
rJMSF016E15- GAAGACGAAATCGAGCTCGTTGAGGCCGAAGTTAGGCCGGGAAGCCATGTCGCCGAG
JMFS048H05+ GAAGACGAAATCGAGCTCGTTGAGGCTGAAGTTAGGCCGGGAAGCCATGTCGCCGAGGAC
JMFF050M08+ ACGAAATCGAGCTCGTGNAGGCCGAAGTTAGNCCGGGAAGCCATGTCGCCGAGGAC
                      ____________________________________________________________
consensus GAAGACGAAATCGAGCTCGTTGAGGCCGAAGTTAGGCCGGGAAGCCATGTCGCCGAGGAC
 
. : . : . : . : . : . :
JMFS048H05+ GCAGGCGGAAACGCCCACCAACTCCTCCATAAGAACCTTGAAAGGGAACTGCGGATCCGC
JMSF016E15+ TCCTCCATAAGAACCTTGAAAGGGAACTGCGGATCCGC
JMFF050M08+ GCAGGCGGAAACGCCCACCAACTCCTCCATAAGAACCTTGAAAGGGAACTGCGGATCCGC
JMSF032H21+ GC
JMFF017F20+ TCCATAAGAACCTTGAAAGGGAACTGCGGATCCGC
JMSF017I02+ TCCTCCATAAGAACCTTGAAAGGGAACTGCGGATCCGC
                      ____________________________________________________________
consensus GCAGGCGGAAACGCCCACCAACTCCTCCATAAGAACCTTGAAAGGGAACTGCGGATCCGC
 
. : . : . : . : . : . :
JMFS048H05+ AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
JMSF016E15+ AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
JMFF050M08+ AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
JMSF032H21+ AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
JMFF017F20+ AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
JMSF017I02+ AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
                      ____________________________________________________________
consensus AGCAACCCTAGATCTCCACCCACTGAGAAAAGCTCCGATCGGACCGAAACTGTCCCCGGA
 
. : . : . : . : . : . :
JMFS048H05+ AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
JMSF016E15+ AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
JMFF050M08+ AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
JMSF032H21+ AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
JMFF017F20+ AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
JMSF017I02+ AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
JMFF048A24+ GCATTCCAATCCCCATCTCTTCCTCCGCCGCCGCCGCCACC
                      ____________________________________________________________
consensus AGATCCGGAATCACCACCTGCATTCCAATCCCCATCTCCTCCTCCGCCGCCGCCGCCACC
 
. : . : . : . : . : . :
JMFS048H05+ TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
JMSF016E15+ TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
JMFF050M08+ TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
JMSF032H21+ TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
JMFF017F20+ TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
JMSF017I02+ TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
JMFF048A24+ TTGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
                      ____________________________________________________________
consensus TCGTCCCACGCCGCTCCCGCCGCCGCCGGCACAAAGGGAAGGCAACTTCAGAAGCGAATC
 
. : . : . : . : . : . :
JMFS048H05+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
JMSF016E15+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
JMFF050M08+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
JMSF032H21+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
JMFF017F20+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
JMSF017I02+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
JMFF048A24+ CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
                      ____________________________________________________________
consensus CGACTCCCATTTCTTCGAAGAAATGGAAACCGTATAATCACCGGAAAACACTGAACCATG
 
. : . : . : . : . : . :
JMFS048H05+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
JMSF016E15+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
JMFF050M08+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
JMSF032H21+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
JMFF017F20+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
JMSF017I02+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
JMFF048A24+ ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
                      ____________________________________________________________
consensus ACCAGAAAAAAGATGCCGACTCGGAGGGCTCAAACGAGAGTTCTGCGTCCGATTCAAGCC
 
. : . : . : . : . : . :
JMFS048H05+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
JMSF016E15+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
JMFF050M08+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
JMSF032H21+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
JMFF017F20+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
JMSF017I02+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
JMFF048A24+ AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
                      ____________________________________________________________
consensus AGCAGTAGTATAGAAATGAAGCTGCGACATCGCCGCCATCTTAACAACTCCGGCGATCCA
 
. : . : . : . : . : . :
JMFS048H05+ ACACAACAAGCCGCGATCTTTCC
JMSF016E15+ ACACAACAAGCCGCGATCTTTCCTTCTCTAAA
JMFF050M08+ ACACAACAAGCCGCGATCTTTCCTTCTCTAAA
JMSF032H21+ ACACAACAAGCCGCGATCTTTCCTTCTCTAAA
JMFF017F20+ ACACAACAAGCCGCGATCTTTCCTTCTCTAAA
JMSF017I02+ ACACAACAAGCCGCGATCTTTCCTTCTCTAAAGATCTCTATCAGCTAC
JMFF048A24+ ACACAACAAGCCGCGATCTTTCCTTCTCTAAAGATCTCTATCAGCTACGCAAAATGGAGT
                      ____________________________________________________________
consensus ACACAACAAGCCGCGATCTTTCCTTCTCTAAAGATCTCTATCAGCTACGCAAAATGGAGT