Previous Contig 002039:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035I08Sequence552002039 (2)gb:AP003375_18287225e-23Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OJ14604001797 (4)gb:AP003914_18351386e-08Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ15
JMFF047N10Sequence605002039 (2)gb:AY050403_15621802e-26Arabidopsis thaliana AT5g46250/MPL12_3 mRNA, complete cds.>gb:BT000588_1634866 A518001797 (4)gb:AP003914_18351383e-07Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047N10+ GGTAA
                      ____________________________________________________________
consensus GGTAA
 
. : . : . : . : . : . :
JMFF035I08+ TCAATGTATGGGAGAGGATT
JMFF047N10+ GTTTTCCACCAATACAGTGCATAGCTGAGGATCCCTGGCCTCAATGTATGGGAGAGGATN
                      ____________________________________________________________
consensus GTTTTCCACCAATACAGTGCATAGCTGAGGATCCCTGGCCTCAATGTATGGGAGAGGATT
 
. : . : . : . : . : . :
JMFF035I08+ TAGTCGCTTCACCCTTTTCCCATCAGAACTGACAACCAGAAGAGAGGAGTCCTTGAGTGC
JMFF047N10+ TAGTCGCTTCACCCTTTTCCCATCAGAACTGACAACCAGAAGAGAGGAGTCCTTGAGTGC
                      ____________________________________________________________
consensus TAGTCGCTTCACCCTTTTCCCATCAGAACTGACAACCAGAAGAGAGGAGTCCTTGAGTGC
 
. : . : . : . : . : . :
JMFF035I08+ AGTCACAATCAGAGGTATCTCCCTGGTCAGCTTCTTCAGTTTTCTAAATGAAGCAATGAC
JMFF047N10+ AGTCACAATCAGAGGTATCTCCCTGGTCAGCTTCTTCAGTTTTCTAAATGAAGCAATGAC
                      ____________________________________________________________
consensus AGTCACAATCAGAGGTATCTCCCTGGTCAGCTTCTTCAGTTTTCTAAATGAAGCAATGAC
 
. : . : . : . : . : . :
JMFF035I08+ TTTAAGAGGAACATATCCTTCCTCATTCTTGGTCACATATTTCAGAAGAAACTTATCCGT
JMFF047N10+ TTTAAGAGGAACATATCCTTCCTCATTCTTGGTCACATATTTCAGAAGAAACTTATCCGT
                      ____________________________________________________________
consensus TTTAAGAGGAACATATCCTTCCTCATTCTTGGTCACATATTTCAGAAGAAACTTATCCGT
 
. : . : . : . : . : . :
JMFF035I08+ TGGCAAATTTTCATCACTGAAGTAATATTCCACCTGCTTGATAATCTTGAGGCGAAGATC
JMFF047N10+ TGGCAAATTTTCATCACTGAAGTAATATTCCACCTGCTTGATAATCTTGAGGCGAAGATC
                      ____________________________________________________________
consensus TGGCAAATTTTCATCACTGAAGTAATATTCCACCTGCTTGATAATCTTGAGGCGAAGATC
 
. : . : . : . : . : . :
JMFF035I08+ ATCGGTGAGAGGAGCGATGGAGGAGGGGTGGGGTTGATCGGAGTGCTGAGGAAGATCCTC
JMFF047N10+ ATCGGTGAGAGGAGCGATGGAGGAGGGGTGGGGTTGATCGGAGTGCTGAGGAAGATCCTC
                      ____________________________________________________________
consensus ATCGGTGAGAGGAGCGATGGAGGAGGGGTGGGGTTGATCGGAGTGCTGAGGAAGATCCTC
 
. : . : . : . : . : . :
JMFF035I08+ GTGGAAGTCAGGGGATCCGACGGGAGAGAAATCAGGATGGTGATCGTCATCTTCGTCGTC
JMFF047N10+ GTGGAAGTCAGGGGATCCGACGGGAGAGAAATCAGGATGGTGATCGTCATCTTCGTCGTC
                      ____________________________________________________________
consensus GTGGAAGTCAGGGGATCCGACGGGAGAGAAATCAGGATGGTGATCGTCATCTTCGTCGTC
 
. : . : . : . : . : . :
JMFF035I08+ AAGCGGTGGAGACGAAGAGGTGGCGGCGACGGTGTGGGAGGTGATGGGGATGAGGACTCC
JMFF047N10+ AAGCGGTGGAGACGAAGAGGTGGCGGCGACGGTGTGGGAGGTGATGGGGATGAGGACTCC
                      ____________________________________________________________
consensus AAGCGGTGGAGACGAAGAGGTGGCGGCGACGGTGTGGGAGGTGATGGGGATGAGGACTCC
 
. : . : . : . : . : . :
JMFF035I08+ CCTGGAGCCGGATCCGGGTTCGGGTTCGGGTTCCATTTCCAGAGAGAGGAGAAGAGGGGT
JMFF047N10+ CCTGGAGCCGGATCCGGGTTCGGGTTCGGGTTCCATTTCCAGAGAGAGGAGAAGAGGGGT
                      ____________________________________________________________
consensus CCTGGAGCCGGATCCGGGTTCGGGTTCGGGTTCCATTTCCAGAGAGAGGAGAAGAGGGGT
 
. : . : . : . : . : . :
JMFF035I08+ GTCTTTCTTTCTTTCCGCTTCGGCTACTTTTCGCTCTTCATCGACTTCCCCT
JMFF047N10+ GTCTTTCTTTCTTTCCGCTTCGGCTACTTTTCGCTCTTCATCGACTTCCCCTGATCTCCC
                      ____________________________________________________________
consensus GTCTTTCTTTCTTTCCGCTTCGGCTACTTTTCGCTCTTCATCGACTTCCCCTGATCTCCC