Previous Contig 002032:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014F12Sequence556002032 (23)pir|T09788|T097884e-73probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip745002032 (23)pir|T09788|T097882e-88probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF015K20Sequence572002032 (23)pir|T09788|T097881e-81probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip710002032 (23)pir|T09788|T097889e-73probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF017O18Sequence563002032 (23)pir|T09788|T097882e-68probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip737002032 (23)pir|T09788|T097884e-83probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF018C10Sequence555002032 (23)pir|T09788|T097884e-73probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip754002032 (23)pir|T09788|T097883e-90probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF025D18Sequence577002032 (23)pir|T09788|T097884e-77probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip745002032 (23)pir|T09788|T097883e-90probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF025H16Sequence575002032 (23)pir|T09788|T097881e-76probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip796002032 (23)pir|T09788|T09788e-101probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF040I21Sequence522002032 (23)pir|T09788|T097882e-65probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip683002032 (23)pir|T09788|T097883e-69probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF043C13Sequence630002032 (23)pir|T09788|T097883e-79probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip545002032 (23)gb:IPBMNSUPDI_16831975e-39Ipomoea batatas Mn-superoxide dismutase mRNA, 3' end.
JMFF047L16Sequence573002032 (23)pir|T09788|T097885e-72probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFF048I10Sequence421002032 (23)sp|P11796|SODM_NICPL5e-47Superoxide dismutase [Mn], mitochondrial precursor (EC 1.15.1.1).>pir|S03639|S03267002032 (23)
JMFF050D02Sequence629002032 (23)pir|T09788|T097882e-79probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFN008A20Sequence621002032 (23)pir|T09788|T097885e-93probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFN025I10Sequence618002032 (23)pir|T09788|T097881e-74probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip
JMFN029B19Sequence640002032 (23)pir|T09788|T097881e-96probable superoxide dismutase (EC 1.15.1.1) (Mn) - papaya>gb:CPAMNSOD_1648539 Ip

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF048I10- CTTTTTTTTTTTTTTTTAGCAGAA
                      ____________________________________________________________
consensus CTTTTTTTTTTTTTTTTAGCAGAA
 
. : . : . : . : . : . :
rJMFF048I10- AAACTCCTGCATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
rJMFF015K20- CTCCTGCATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
rJMFF040I21- ATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
JMFN025I10+ CAGTGTG
rJMFF043C13- TGCATTTTTCTATTTTAACTCTGATAAAGCGATAAGTTTCACATCACAGTGTG
rJMFF014F12- CTCCTGCATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
rJMFF017O18- TTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
rJMFF018C10- CTCCTGCATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
rJMFF025D18- ATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
rJMFF025H16- TTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
                      ____________________________________________________________
consensus AAACTCCTGCATTTTTCGATTTTAACTCTGTTGAAGTGATAAGTTTCACATCACAGTGTG
 
. : . : . : . : . : . :
rJMFF048I10- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF015K20- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF040I21- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
JMFN025I10+ CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF043C13- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAAAAG
rJMFF014F12- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF017O18- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF018C10- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF025D18- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
rJMFF025H16- CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
                      ____________________________________________________________
consensus CTAAAAGCAACAAAATCCACAAATACAACAATTTATTTACCATTACACAGAAAACAGAAG
 
. : . : . : . : . : . :
rJMFF048I10- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
rJMFF015K20- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
rJMFF040I21- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTATATCCCACGGA
JMFN025I10+ CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCAAGGA
rJMFF043C13- CAACAACTCTTCACCATAAAGCCGAAACAAAGTTAACTTACCATTATTTTATCCCCCGGA
rJMFF014F12- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
rJMFF017O18- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
rJMFF018C10- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
rJMFF025D18- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
rJMFF025H16- CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
                      ____________________________________________________________
consensus CAACAACACTTCAGCAGAAAGCCGAAGCAAAGTTAACTTAGCATTATTTTATCCCACGGA
 
. : . : . : . : . : . :
rJMFF048I10- ATTAAAGAAAATTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF015K20- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF040I21- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
JMFN025I10+ ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF043C13- ATTAAAGAAATTTGGGCACCTTGATGACCGGTGTATCACCCGGTGTGATCACTCTCTGCT
rJMFF014F12- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF017O18- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF018C10- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF025D18- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
rJMFF025H16- ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
                      ____________________________________________________________
consensus ATTAAAGAAATTTGGGCACCTTGATGAGTGTTGTATCACCCGGTGTGATCAGTCTCTGCT
 
. : . : . : . : . : . :
rJMFF048I10- TGC
rJMFF015K20- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
rJMFF040I21- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
JMFN025I10+ TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
rJMFF043C13- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGATCACAACTTT
rJMFF014F12- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
rJMFF017O18- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
rJMFF018C10- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
rJMFF025D18- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
rJMFF025H16- TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
JMFN029B19+ CAACTTT
                      ____________________________________________________________
consensus TGCAGGCAATGGGGTAAATTGTTGGTAAACCTCACATGCATATTTCCAGTTCACAACTTT
 
. : . : . : . : . : . :
rJMFF015K20- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
rJMFF040I21- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
JMFN025I10+ CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
rJMFF043C13- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGAATGCATGGTC
rJMFF014F12- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
rJMFF017O18- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
rJMFF018C10- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
rJMFF025D18- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
rJMFF025H16- CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
JMFN008A20+ TCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
JMFN029B19+ CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
                      ____________________________________________________________
consensus CCATATATTCTTCAAGTAATCCGGCCTCACATTCTTGTACTGTAAGTAGTATGCATGTTC
 
. : . : . : . : . : . :
rJMFF015K20- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
rJMFF040I21- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
JMFN025I10+ CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
rJMFF043C13- CCAAACATCTATGCCCAAAAAAGGAACCAAGTTTGGATTTA-CCGTAACCAAAGGGACCT
rJMFF014F12- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
rJMFF017O18- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
rJMFF018C10- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
rJMFF025D18- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
rJMFF025H16- CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
JMFN008A20+ CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
JMFN029B19+ CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
JMFF015K20+ CCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
JMFF050D02+ TTGGATTTA-CAGTANCCAAAGGGTCCT
JMFF043C13+ TTGGATTTACCAGTAACCAAAGGGTCCT
                      ____________________________________________________________
consensus CCAAACATCTATGCCCAGTAGAGGAACCAAGTTTGGATTTA-CAGTAACCAAAGGGTCCT
 
. : . : . : . : . : . :
rJMFF015K20- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
rJMFF040I21- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFN025I10+ GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
rJMFF043C13- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGGCCAAACCCAACCACACCC
rJMFF014F12- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
rJMFF017O18- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
rJMFF018C10- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
rJMFF025D18- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
rJMFF025H16- GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFN008A20+ GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFN029B19+ GATTCGTAGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF015K20+ GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF050D02+ GATTT-GGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF043C13+ GATTT-GGGGTGGTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF025H16+ ACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF025D18+ CCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF018C10+ GTCCAAACCCAGCCACACCC
JMFF014F12+ TGTCCAAACCCAGCCACACCC
JMFF017O18+ TCAGCTCTTTGTCCAAACCCAGCCACACCC
JMFF047L16+ AAGATGCTTCAGCTC-TTGTCCAAACGCAGCCACACCC
                      ____________________________________________________________
consensus GATTTGGGGTGGTTTGAACCACAAGATGCTTCAGCTCTTTGTCCAAACCCAGCCACACCC
 
. : . : . : . : . : . :
rJMFF015K20- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
rJMFF040I21- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFN025I10+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
rJMFF043C13- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATGAGAGCATCTAAAG
rJMFF014F12- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
rJMFF017O18- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
rJMFF018C10- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
rJMFF025D18- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
rJMFF025H16- AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFN008A20+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFN029B19+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF015K20+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF050D02+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF043C13+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF025H16+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF025D18+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF018C10+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF040I21+ TACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF014F12+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF017O18+ AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
JMFF047L16+ AGCCAGAACCTNGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
                      ____________________________________________________________
consensus AGCCAGAACCTTGTACAGCAGCACCTTCTGCAGACATCTTTTGTATCAGAGCATCTAAAG
 
. : . : . : . : . : . :
rJMFF015K20- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
rJMFF040I21- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFN025I10+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
rJMFF043C13- AGCC
rJMFF014F12- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
rJMFF017O18- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
rJMFF018C10- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
rJMFF025D18- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
rJMFF025H16- AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFN008A20+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFN029B19+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF015K20+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF050D02+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF043C13+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF025H16+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF025D18+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF018C10+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF040I21+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF048I10+ CTCCTT
JMFF014F12+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF017O18+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
JMFF047L16+ AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
                      ____________________________________________________________
consensus AGCCAAAGTGATTGTCAATCTCCCAGCCCAAAGAACTCTTCGGAGGCTCGCCACCTCCTT
 
. : . : . : . : . : . :
rJMFF015K20- CCCGAATA-GGGGCAAGGTTCTTCCAGAAAAATTGAGTGGTTTATATGGCCTCCG-CCGT
rJMFF040I21- CCCGAATAGGGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCGNCCGT
JMFN025I10+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
rJMFF014F12- CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
rJMFF017O18- CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTT--TATGGCCTCCG-CCGT
rJMFF018C10- CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
rJMFF025D18- CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
rJMFF025H16- CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFN008A20+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFN029B19+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF015K20+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF050D02+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF043C13+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF025H16+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF025D18+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF018C10+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF040I21+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF048I10+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF014F12+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
JMFF017O18+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTT--TATGGCCTCCG-CCGT
JMFF047L16+ CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
                      ____________________________________________________________
consensus CCCGAATA-GGGGCAAGGTTCTTCCAG-AAAATTGAGTGGTTTATATGGCCTCCG-CCGT
 
. : . : . : . : . : . :
rJMFF015K20- TGAACTTGATGGGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGAT
rJMFF040I21- TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCG
JMFN025I10+ TGAACTTGAT-GGCGC
rJMFF014F12- TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
rJMFF017O18- TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
rJMFF018C10- TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
rJMFF025D18- TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
rJMFF025H16- TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFN008A20+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFN029B19+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF015K20+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF050D02+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF043C13+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF025H16+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF025D18+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF018C10+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF040I21+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF048I10+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF014F12+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF017O18+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
JMFF047L16+ TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
                      ____________________________________________________________
consensus TGAACTTGAT-GGCGCTCTGCAATTTGACGGCGGCGGACGCATCGCCCTTGCTGATGGCC
 
. : . : . : . : . : . :
rJMFF014F12- TCGTGGAGCTGCTCGAGAGCCTTGTTGTA
rJMFF017O18- TCGTGGAGCTGCTCGAGAGCCTTGTTGTANTTGG
rJMFF018C10- TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACG
rJMFF025D18- TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGT
rJMFF025H16- TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTANGCCTGGTGATGCTTCTGG
JMFN008A20+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFN029B19+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF015K20+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF050D02+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF043C13+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF025H16+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF025D18+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF018C10+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF040I21+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF048I10+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF014F12+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF017O18+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
JMFF047L16+ TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
                      ____________________________________________________________
consensus TCGTGGAGCTGCTCGAGAGCCTTGTTGTAGTTGGTGACGTAGGCCTGGTGATGCTTCTGG
 
. : . : . : . : . : . :
rJMFF025H16- TGATGAAGCTGCATGATCTCTCCGCTAATGGC
JMFN008A20+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFN029B19+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF015K20+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF050D02+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF043C13+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF025H16+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF025D18+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF018C10+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF040I21+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF048I10+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF014F12+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
JMFF017O18+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTAATAGGAA
JMFF047L16+ TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
                      ____________________________________________________________
consensus TGATGAAGCTGCATGATCTCTCCGCTAATGGCGGGCTCCAGGGCGCCGTAGTCATAGGAA
 
. : . : . : . : . : . :
JMFN008A20+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFN029B19+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF015K20+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF050D02+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF043C13+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF025H16+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF025D18+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF018C10+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF040I21+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF048I10+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF014F12+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF017O18+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
JMFF047L16+ AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
                      ____________________________________________________________
consensus AGATCAGGAAGCGTGGCGGTCTGCAAGCTGCGCAGCTGCTGCCGGAACGCTTGCGCGGTG
 
. : . : . : . : . : . :
JMFN008A20+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTG
JMFN029B19+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGC
JMFF015K20+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTAT
JMFF050D02+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF043C13+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF025H16+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF025D18+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF018C10+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF040I21+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF048I10+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF014F12+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF017O18+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
JMFF047L16+ GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
                      ____________________________________________________________
consensus GCGGAAAGGGATTTTCGGGTGGCTAGGTTTCGAAGTGCCATTGCCGGTATACTCTTCCTT
 
. : . : . : . : . : . :
JMFF050D02+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF043C13+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF025H16+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF025D18+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF018C10+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF040I21+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF048I10+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF014F12+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF017O18+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAAC
JMFF047L16+ CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAACC
                      ____________________________________________________________
consensus CTTCTTCGAGATTCTGTTAGTATATATCGAGCAGTCGAGAAAGTGAGAGACGGCAAAACC