Previous Contig 002030:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF047K09Sequence491002030 (2)407002030 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF047K09- TTCAGACAATAT
                      ____________________________________________________________
consensus TTCAGACAATAT
 
. : . : . : . : . : . :
rJMFF047K09+ TCAT
JMFF047K09- ATCTAGCAAGCAGCTAGCAATGGCTACAAGATCTGCCATGATCCTAACTGTAATCTTCAT
                      ____________________________________________________________
consensus ATCTAGCAAGCAGCTAGCAATGGCTACAAGATCTGCCATGATCCTAACTGTAATCTTCAT
 
. : . : . : . : . : . :
rJMFF047K09+ TATTGCTTTGGTTATATCTCCTGCAATACCTTTCACAGATGCAGCTCGGCCTACAACTTT
JMFF047K09- TATTGCTTTGGTTATATCTCCTGCAATTACCTTCACAGATGCAGCTCGGCCTACAACTTT
                      ____________________________________________________________
consensus TATTGCTTTGGTTATATCTCCTGCAATTCCTTTCACAGATGCAGCTCGGCCTACAACTTT
 
. : . : . : . : . : . :
rJMFF047K09+ TAAAGAGGTGTTGGGGAGAAGGCCTATATGTCCGGCCTGTGTATGCTGTGAGCCGCCGCC
JMFF047K09- TAAAGAGGTGTTGGGGAGAAGGCCTATATGTCCGGCCTGTGTATGCTGTGAGCCGCCGCC
                      ____________________________________________________________
consensus TAAAGAGGTGTTGGGGAGAAGGCCTATATGTCCGGCCTGTGTATGCTGTGAGCCGCCGCC
 
. : . : . : . : . : . :
rJMFF047K09+ GCCGGGATCTTGTTGCCGTTGCGGCTGCGGTGCCGGCGGCCCCATTACCACCCAGTCCCA
JMFF047K09- GCCGGGATCTTGTTGCCGTTGCGGCTGCGGTGCCGGCGGCCCCATTACCACCCAGTCCCA
                      ____________________________________________________________
consensus GCCGGGATCTTGTTGCCGTTGCGGCTGCGGTGCCGGCGGCCCCATTACCACCCAGTCCCA
 
. : . : . : . : . : . :
rJMFF047K09+ TGAAGCTTCTCCGCCGTGATAAGCAACTTTCCGGCTGCTCGATCATAAGGCTTTAATTAA
JMFF047K09- TGAAGCTTCTCCGCCGTGATAAGCAACTTTCCGGCTGCTCGATCATAAGGCTTTAATTAA
                      ____________________________________________________________
consensus TGAAGCTTCTCCGCCGTGATAAGCAACTTTCCGGCTGCTCGATCATAAGGCTTTAATTAA
 
. : . : . : . : . : . :
rJMFF047K09+ CATTTGTTTCTCCAAATAAATGAAATGAAACAAAAGTCACTCCGTTACCCCTTTCTGGGG
JMFF047K09- CATTTGTTTCTCCAAATAAATGAAATGAAACAAAAGTCACTCCGTTACCCCTTTCTGGGG
                      ____________________________________________________________
consensus CATTTGTTTCTCCAAATAAATGAAATGAAACAAAAGTCACTCCGTTACCCCTTTCTGGGG
 
. : . : . : . : . : . :
rJMFF047K09+ AATTACGTACGGTTTATTGTATTATTCATGTGTTTATGGTTTTCTGTATTCCTGCTATGA
JMFF047K09- AATTACGTACGGNTTATTGTATTATTCATGTGTTTATGGTTTTCTGTATTCCTGCTATGA
                      ____________________________________________________________
consensus AATTACGTACGGTTTATTGTATTATTCATGTGTTTATGGTTTTCTGTATTCCTGCTATGA
 
. : . : . : . : . : . :
rJMFF047K09+ AATTATT-AAATTCAAGGACAACCTATCTGTCAATGTACGTAAT
JMFF047K09- AATTATTAAAATTCAGGGAC-ACCTATCTGTNCATGTACGTAATAAAAAAAAAAAAAAAG
                      ____________________________________________________________
consensus AATTATTAAAATTCAGGGACAACCTATCTGTCCATGTACGTAATAAAAAAAAAAAAAAAG