Previous Contig 002026:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF041G16Sequence620002026 (2)gb:AY124861_15802262e-09Arabidopsis thaliana AT5g60580/muf9_230 mRNA, complete cds.>gb:AF367330_1791782 634003109 (4)gb:AB011483_15115114e-25Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUF9.
JMFF047I17Sequence491002026 (2)gb:AY124861_15802260.002Arabidopsis thaliana AT5g60580/muf9_230 mRNA, complete cds.>gb:AF367330_1791782 314003109 (4)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF041G16+ AGAGTGACCAAGACCTGGAGATGG
                      ____________________________________________________________
consensus AGAGTGACCAAGACCTGGAGATGG
 
. : . : . : . : . : . :
JMFF041G16+ AGATGGACACTACTTTGTCTTGTGGAGCTGTGGCAGAACAACCCAAATCAATATCTGGAG
                      ____________________________________________________________
consensus AGATGGACACTACTTTGTCTTGTGGAGCTGTGGCAGAACAACCCAAATCAATATCTGGAG
 
. : . : . : . : . : . :
JMFF041G16+ CCTTCTCCATATCCAGATTGGAATTATGGGACATGAAGTTTAGTTTGGGCAGTAAATTCC
                      ____________________________________________________________
consensus CCTTCTCCATATCCAGATTGGAATTATGGGACATGAAGTTTAGTTTGGGCAGTAAATTCC
 
. : . : . : . : . : . :
JMFF041G16+ TTATGGATGATTTGGCTCTGGGGAGGTGGCCTGGAGATCCATTCACTCTGGGATCAGAAG
JMFF047I17+ GGATGATTTGGCTCTGGGGAGGTGCCCTGGAGATCCATTCACTCTGGGATCAGAAG
                      ____________________________________________________________
consensus TTATGGATGATTTGGCTCTGGGGAGGTGGCCTGGAGATCCATTCACTCTGGGATCAGAAG
 
. : . : . : . : . : . :
JMFF041G16+ GACTAGGAGTCACAAGAAAATTCACCTTCTTTGCAGTTGGGGTAGGGGTCAAAAGCTTCT
JMFF047I17+ GACTAGGAGTCACAAGAAAATTCACCTTCTTTGCAGTTGGGGTAGGGGTCAAAAGCTTCT
                      ____________________________________________________________
consensus GACTAGGAGTCACAAGAAAATTCACCTTCTTTGCAGTTGGGGTAGGGGTCAAAAGCTTCT
 
. : . : . : . : . : . :
JMFF041G16+ TAATCTGAACAATTTCTTCACGGGAATTCTGCAAACTCATCATAGGTATTTCCAGTGAAA
JMFF047I17+ TAATCTGAACAATTTCTTCACGGGAATTCTGCAAACTCATCATAGGTATTTCCAGTGAAA
                      ____________________________________________________________
consensus TAATCTGAACAATTTCTTCACGGGAATTCTGCAAACTCATCATAGGTATTTCCAGTGAAA
 
. : . : . : . : . : . :
JMFF041G16+ GATTGGGCCTTCTCCCATGTTTAACTTGTGTTATTTCTTCAATTATTCCAGAGGAACTTA
JMFF047I17+ GATTGGGCCTTCTCCCATGTTTAACTTGTGTTATTTCTTCAATTATTCCAGAGGAACTTA
                      ____________________________________________________________
consensus GATTGGGCCTTCTCCCATGTTTAACTTGTGTTATTTCTTCAATTATTCCAGAGGAACTTA
 
. : . : . : . : . : . :
JMFF041G16+ GAGACTTAGGGATTGAAATCCCAGTTTCTCTTCTTCCACCATTCTGCACATCTTCCCCCT
JMFF047I17+ GAGACTTAGGGATTGAAATCCCAGTTTCTCTTCTTCCACCATTCTGCACATCTTCCCCCT
                      ____________________________________________________________
consensus GAGACTTAGGGATTGAAATCCCAGTTTCTCTTCTTCCACCATTCTGCACATCTTCCCCCT
 
. : . : . : . : . : . :
JMFF041G16+ CACTCAAGAAAGTTTCTTTCTTTTCCCTGTCCATGACACCAGTACGCTGAAATCCGGCAG
JMFF047I17+ CACTCAAGAAAGTTTCTTTCTTTTCCCTGTCCATGACACCAGTACGCTGAAATCCGGCAG
                      ____________________________________________________________
consensus CACTCAAGAAAGTTTCTTTCTTTTCCCTGTCCATGACACCAGTACGCTGAAATCCGGCAG
 
. : . : . : . : . : . :
JMFF041G16+ TTTTGCCAGAAATCCTCAAACAAACAAGGCTGTTACGCTCCAAGAGAGCTGGGAAATGAA
JMFF047I17+ TTTTGCCAGAAATCCTCAAACAAACAAGGCTGTTACGCTCCAAGAGAGCTGGGAAATGAA
                      ____________________________________________________________
consensus TTTTGCCAGAAATCCTCAAACAAACAAGGCTGTTACGCTCCAAGAGAGCTGGGAAATGAA
 
. : . : . : . : . : . :
JMFF041G16+ AAATATGATGATATGAACCTCGTCGTATAAGTCCTAGATAGGGAAAATGTTGAGAG
JMFF047I17+ AAATATGATGATATGAACCTCGTCGTATAAGTCCTAGATAGGGAAAATGTTGAGAGGCGG
                      ____________________________________________________________
consensus AAATATGATGATATGAACCTCGTCGTATAAGTCCTAGATAGGGAAAATGTTGAGAGGCGG