Previous Contig 002022:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B10Sequence539002022 (4)pir|A96555|A965552e-42unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_893077 Arabidopsis109013056 (5)gb:AJ628349_18125340.001Nicotiana suaveolens mRNA for S-adenosyl-L-methionine:benzoic acid/salicylic aci
JMFF010H23Sequence544002022 (4)pir|A96555|A965552e-21unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_893077 Arabidopsis771010739 (6)gb:AY863145_16309883e-67Flaveria brownii unknown mRNA.
JMFF013D24Sequence527002022 (4)pir|A96555|A965551e-27unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_893077 Arabidopsis814010739 (6)gb:AY863145_16309881e-68Flaveria brownii unknown mRNA.
JMFF047H12Sequence566002022 (4)pir|A96555|A965552e-23unknown protein [imported] - Arabidopsis thaliana>gb:AE005173_893077 Arabidopsis486010739 (6)gb:AY088029_15730535e-20Arabidopsis thaliana clone 40534 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF007B10+ CCTTCACCACGGC
                      ____________________________________________________________
consensus CCTTCACCACGGC
 
. : . : . : . : . : . :
JMFF007B10+ AAGGTCTTTCGCAGATAACCTAGCGGGTGGAGAGGTAGCAACTTTCACCACTCCATCCAA
                      ____________________________________________________________
consensus AAGGTCTTTCGCAGATAACCTAGCGGGTGGAGAGGTAGCAACTTTCACCACTCCATCCAA
 
. : . : . : . : . : . :
JMFF007B10+ GCTTTTCACAAAGTTTTCAACATTGTAGATATCTCCAAAGTTCCTCTTATCACCGGGATT
                      ____________________________________________________________
consensus GCTTTTCACAAAGTTTTCAACATTGTAGATATCTCCAAAGTTCCTCTTATCACCGGGATT
 
. : . : . : . : . : . :
JMFF007B10+ GCTTCCCCTAATATCAGGGAGTACAAGAGTTGCTCGTAGATATCTTGCAACTACTACTGC
JMFF013D24+ AATATCAGGGAGTACAAGAGTTGCTCGTAGATATCTTGCAACTACTACTGC
JMFF010H23+ TACTGC
                      ____________________________________________________________
consensus GCTTCCCCTAATATCAGGGAGTACAAGAGTTGCTCGTAGATATCTTGCAACTACTACTGC
 
. : . : . : . : . : . :
JMFF007B10+ ATCAGCAATCTGTGAGATGTGATACTCGGGACCTTTTGTCAATGAGAAGGTAAGAAATCC
JMFF013D24+ ATCAGCAATCTGTGAGATGTGATACTCGGGACCTTTTGTCAATGAAAAGGTAAGAAATCC
JMFF010H23+ ATCAGCAATCTGTGAGATGTGATACTCGGGACCTTTTGTCAATGAGAAGGTAAGAAATCC
                      ____________________________________________________________
consensus ATCAGCAATCTGTGAGATGTGATACTCGGGACCTTTTGTCAATGAGAAGGTAAGAAATCC
 
. : . : . : . : . : . :
JMFF007B10+ TTGTGATTGGTCTTCCTCCTCCAAAACTGGTTTACTCCAGCATGGCTTAAGGGACATACC
JMFF013D24+ TTGTGATTGGTCTTCCTCCTCCAAAACTGGTTTACTCCAGCATGGCTTAAGGGACATACC
JMFF010H23+ TTGTGATTGGTCTTCCTCCTCCAAAACTGGTTTACTCCAGCATGGCTTAAGGGACATACC
                      ____________________________________________________________
consensus TTGTGATTGGTCTTCCTCCTCCAAAACTGGTTTACTCCAGCATGGCTTAAGGGACATACC
 
. : . : . : . : . : . :
JMFF007B10+ ATCACCTTTCCAAGGTCCATCTCCCCCTGGAAGTGAAAGTTCTGAGGTTTTGGTAGTGTC
JMFF013D24+ ATCACCTTTCCAAGGTCCATCTCCCCCTGGAAGTGAAAGTTCTGAGGTTTTGGTAGTGTC
JMFF010H23+ ATCACCTTTCCAAGGTCCATCTCCCCCTGGAAGTGAAAGTTCTGAGGTTTTGGTAGTGTC
                      ____________________________________________________________
consensus ATCACCTTTCCAAGGTCCATCTCCCCCTGGAAGTGAAAGTTCTGAGGTTTTGGTAGTGTC
 
. : . : . : . : . : . :
JMFF007B10+ ATGAATGCTCACCTGGACGTGATCGAAATGATCTCTCTTGATCATGTTACCCAGCATTAC
JMFF013D24+ ATGAATGCTCACCTGGACGTGATCGAAATGATCTCTCTTGATCATGTTACCCAGCATTAC
JMFF010H23+ ATGAATGCTCACCTGGACGTGATCGAAATGATCTCTCTTGATCATGTTACCCAGCATTAC
JMFF047H12+ ATCGAAATGATCTCTCTTGATCATGTTACCCAGCATTAC
                      ____________________________________________________________
consensus ATGAATGCTCACCTGGACGTGATCGAAATGATCTCTCTTGATCATGTTACCCAGCATTAC
 
. : . : . : . : . : . :
JMFF007B10+ GAACATGGTGACCGTCAGCACTCCCGCCACCACTTGTCTCGGATCCACCGCCATTTCTTC
JMFF013D24+ GAACATGGTGACCGTCAGCACTCCCGCCACCACTTGTCTCGGATCCACCGCCATTTCTTC
JMFF010H23+ GAACATGGTGACCGTCAGCACTCCCGCCACCACTTGTCTCGGATCCACCGCCATTTCTTC
JMFF047H12+ GAACATGGTGACCGTCAGCACTCCCGCCACCACTTGTCTCGGATCCACCGCCATTTCTTC
                      ____________________________________________________________
consensus GAACATGGTGACCGTCAGCACTCCCGCCACCACTTGTCTCGGATCCACCGCCATTTCTTC
 
. : . : . : . : . : . :
JMFF007B10+ AGATCCAAAACTCCTCTCTCTCTCTCTCTATCTCTCAATCTCTCT
JMFF013D24+ AGATCCAAAACTCCTCTCTCTCTCTCTCTATCTCTCAATCTCTCTCAAGATTCAATAACC
JMFF010H23+ AGATCCAAAACTCCTCTCTCTCTCTCTCTATCTCTCAATCTCTCTCAAGATTCAATAACC
JMFF047H12+ AGATCCAAAACTCCTCTCTCTCTCTCTCTATCTCTCAATCTCTCTCAAGATTCAATAACC
                      ____________________________________________________________
consensus AGATCCAAAACTCCTCTCTCTCTCTCTCTATCTCTCAATCTCTCTCAAGATTCAATAACC
 
. : . : . : . : . : . :
JMFF013D24+ AACTGACCCACTTATATAAATGCGTGCGAAATGATGAAACGGGAAGTGGGCTGAATTGGA
JMFF010H23+ AACTGACCCACTTATATAAATGCGTGCGAAATGATGAAACGGGAAGTGGGCTGAATTGGA
JMFF047H12+ AACTGACCCACTTATATAAATGCGTGCGAAATGATGAAACGGGAAGTGGGCTGAATTGGA
                      ____________________________________________________________
consensus AACTGACCCACTTATATAAATGCGTGCGAAATGATGAAACGGGAAGTGGGCTGAATTGGA
 
. : . : . : . : . : . :
JMFF013D24+ GCCTAAAAGCCAAATAAGGGCAGGCGAGAGAAGAGAGGTATGGCAGATT
JMFF010H23+ GCCTAAAAGCCAAATAAGGGCAGGCGAGAGAAGAGAGGTATGGCAGATTACACCATTGAT
JMFF047H12+ GCCTAAAAGCCAAATAAGGGCAGGCGAGAGAAGAGAGGTATGGCAGATTACACCATTGAT
                      ____________________________________________________________
consensus GCCTAAAAGCCAAATAAGGGCAGGCGAGAGAAGAGAGGTATGGCAGATTACACCATTGAT
 
. : . : . : . : . : . :
JMFF010H23+ GACTTGCTAGGAACTTTATAGAGCTGATGCTTACAAGCAAACAAAGCTCAACTACT
JMFF047H12+ GACTTGCTAGGAACTTTATAGAGCTGATGCTTACAAGCAAACAAAGCTCAACTACTAGTC
                      ____________________________________________________________
consensus GACTTGCTAGGAACTTTATAGAGCTGATGCTTACAAGCAAACAAAGCTCAACTACTAGTC