Previous Contig 002021:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF035E21Sequence602002021 (4)gb:AP003299_18276314e-24Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P069291009859 (2)
JMFF047H08Sequence572002021 (4)268021788
JMFS009F09Sequence633002021 (4)
JMSF044O05Sequence719002021 (4)411009859 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF035E21+ GTACTTCTCAACATCTGGATATATT
                      ____________________________________________________________
consensus GTACTTCTCAACATCTGGATATATT
 
. : . : . : . : . : . :
JMFF035E21+ GACTGAATTATTGCATCAAAGATGGGATCGTCTCTTAACGAACGCCGAGCACAGTGTATG
                      ____________________________________________________________
consensus GACTGAATTATTGCATCAAAGATGGGATCGTCTCTTAACGAACGCCGAGCACAGTGTATG
 
. : . : . : . : . : . :
JMFF035E21+ CGGCAAGCAGGACACTCATTGTTCCCCAATCTCATTGACTTATCAATGCACTCCCTGCAA
                      ____________________________________________________________
consensus CGGCAAGCAGGACACTCATTGTTCCCCAATCTCATTGACTTATCAATGCACTCCCTGCAA
 
. : . : . : . : . : . :
JMFF035E21+ AAACGGTGTTGGCACCCCATCACAACACGAGTTCTCTTGATGATACATAAAAAGCCAACA
                      ____________________________________________________________
consensus AAACGGTGTTGGCACCCCATCACAACACGAGTTCTCTTGATGATACATAAAAAGCCAACA
 
. : . : . : . : . : . :
JMFF035E21+ ATACTTGGACAAATAGGGGCAGGCATTCTACACCTCTACGAGCTTCAAGTACTCAAAAAA
JMSF044O05+ ACGAGCTTCAAGTACTCAAAAAA
                      ____________________________________________________________
consensus ATACTTGGACAAATAGGGGCAGGCATTCTACACCTCTACGAGCTTCAAGTACTCAAAAAA
 
. : . : . : . : . : . :
JMFF035E21+ AGTTGCATCACAACTCTAGCAAAAATGCAAAAATTTATAATAGTATATATTTAAATTTTA
JMSF044O05+ AGTTGCATCACAACTCTAGCAAAAATGCAAAAATTTATAATAGTATATATTTAAATTTTA
                      ____________________________________________________________
consensus AGTTGCATCACAACTCTAGCAAAAATGCAAAAATTTATAATAGTATATATTTAAATTTTA
 
. : . : . : . : . : . :
JMFF035E21+ AAATAATAAAAGATAAATGTCTGAGTACCTAGGCATATTGGGCATTGTACATTGCCACGA
JMSF044O05+ AAATAATAAAAGATAAATGTCTGAGTACCTAGGCATATTGGGCATTGTACATTGCCACGA
JMFS009F09+ CTAGGCATATTGGGCATTGTACATTGCCACGA
                      ____________________________________________________________
consensus AAATAATAAAAGATAAATGTCTGAGTACCTAGGCATATTGGGCATTGTACATTGCCACGA
 
. : . : . : . : . : . :
JMFF035E21+ ATATCTGATCGTGACACAGAAATCAACTCGTCAAAGTCTTCAGGATCAGTTCCACTCCCA
JMSF044O05+ ATATCTGATCGTGACACAGAAATCAACTCGTCAAAGTCTTCAGGATCAGTTCCACTCCCA
JMFS009F09+ ATATCTGATCGTGACACAGAAATCAACTCGTCAAAGTCTTCAGGATCAGTTCCACTCCCA
JMFF047H08+ CGTCAAAGTCTTCAGGATCAGTTCCACTCCCA
                      ____________________________________________________________
consensus ATATCTGATCGTGACACAGAAATCAACTCGTCAAAGTCTTCAGGATCAGTTCCACTCCCA
 
. : . : . : . : . : . :
JMFF035E21+ TCAGAATCATCCTCAGAAGATTCTCTGATTGATTCCTGATCATGATTGGGCGCCTGCTCC
JMSF044O05+ TCAGAATCATCCTCAGAAGATTCTCTGATTGATTCCTGATCATGATTGGGCGCCTGCTCC
JMFS009F09+ TCAGAATCATCCTCAGAAGATTCTCTGATTGATTCCTGATCATGATTGGGCGCCTGCTCC
JMFF047H08+ TCAGAATCATCCTCAGAAGATTCTCTGATTGATTCCTGATCATGATTGGGCGCCTGCTCC
                      ____________________________________________________________
consensus TCAGAATCATCCTCAGAAGATTCTCTGATTGATTCCTGATCATGATTGGGCGCCTGCTCC
 
. : . : . : . : . : . :
JMFF035E21+ TCCAGCTGCGCCCGTTCCTGCTCTCCCGTTTCTAGCTGGATTCGTTGCTGCTGTTGCTGT
JMSF044O05+ TCCAGCTGCGCCCGTTCCTGCTCTCCCGTTTCTAGCTGGATTCGTTGCTGCTGTTGCTGT
JMFS009F09+ TCCAGCTGCGCCCGTTCCTGCTCTCCCGTTTCTAGCTGGATTCGTTGCTGCTGTTGCTGT
JMFF047H08+ TCCAGCTGCGCCCGTTCCTGCTCTCCCGTTTCTAGCTGGATTCGTTGCTGCTGTTGCTGT
                      ____________________________________________________________
consensus TCCAGCTGCGCCCGTTCCTGCTCTCCCGTTTCTAGCTGGATTCGTTGCTGCTGTTGCTGT
 
. : . : . : . : . : . :
JMFF035E21+ AGCTCGTCTTCCGGAGCTCGGTTTTGTTCCGCGCCGC
JMSF044O05+ AGCTCGTCTTCCGGAGCTCGGTTTTGTTCCCCGCCGCCACCACCGCGACGTCGAGATTGC
JMFS009F09+ AGCTCGTCTTCCGGAGCTCGGTTTTGTTCCCCGCCGCCACCACCGCGACGTCGAGATTGC
JMFF047H08+ AGCTCGTCTTCCGGAGCTCGGTTTTGTTCCCCGCCGCCACCACCGCGACGTCGAGATTGC
                      ____________________________________________________________
consensus AGCTCGTCTTCCGGAGCTCGGTTTTGTTCCCCGCCGCCACCACCGCGACGTCGAGATTGC
 
. : . : . : . : . : . :
JMSF044O05+ TTCCCACGGCGCCGTTGATTCCGCCGGTGTTGGGGCTGATACAAGCTCTCATCATNGTCT
JMFS009F09+ TTCCCACGGCGCCGTTGATTCCGCCGGTGTTGGGGCTGATACAAGCTCTCATCATCGTCT
JMFF047H08+ TTCCCACGGCGCCGTTGATTCCGCCGGTGTTGGGGCTGATACAAGCTCTCATCATCGTCT
                      ____________________________________________________________
consensus TTCCCACGGCGCCGTTGATTCCGCCGGTGTTGGGGCTGATACAAGCTCTCATCATCGTCT
 
. : . : . : . : . : . :
JMSF044O05+ TCGTCNTGATAATTCGACGAATAGCGCTTCTGCGCCGGCATTTCCCTCCTCTCTGCGCCC
JMFS009F09+ TCGTCCTGATAATTCGACGAATAGCGCTTCTGCGCCGGCATTTCCCTCCTCTCTGCGCCC
JMFF047H08+ TCGTCCTGATAATTCGACGAATAGCGCTTCTGCGCCGGCATTTCCCTCCTCTCTGCGCCC
                      ____________________________________________________________
consensus TCGTCCTGATAATTCGACGAATAGCGCTTCTGCGCCGGCATTTCCCTCCTCTCTGCGCCC
 
. : . : . : . : . : . :
JMSF044O05+ ACGCTTTGCCTTTACAGATTATTGGCTCCTCCCTCCGTCATCTATATGCACATATCAACA
JMFS009F09+ ACGCTTTGCCTTTACAGATTATTGGCTCCTCCCTCCGTCATCTATATGCACATATCAACA
JMFF047H08+ ACGCTTTGCCTTTACAGATTATTGGCTCCTCCCTCCGTCATCTATATGCACATATCAACA
                      ____________________________________________________________
consensus ACGCTTTGCCTTTACAGATTATTGGCTCCTCCCTCCGTCATCTATATGCACATATCAACA
 
. : . : . : . : . : . :
JMSF044O05+ TATACGCATACGTATATTTGTAATCTATATACATATAAGTGGAGATATTCAAAGAAGAAG
JMFS009F09+ TATACGCATACGTATATTTGTAATCTATATACATATAAGTGGAGATATTCAAAGAAGAAG
JMFF047H08+ TATACGCATACGTATATTTGTAATCTATATACATATAAGTGGAGATATTCAAAGAAGAAG
                      ____________________________________________________________
consensus TATACGCATACGTATATTTGTAATCTATATACATATAAGTGGAGATATTCAAAGAAGAAG
 
. : . : . : . : . : . :
JMSF044O05+ CAAAATTGGGAGAGGGCAAANTGATAAGAATGTATATGTAAACTGTGCTCTTCGCTTTCT
JMFS009F09+ CAAAATTGGGAGAGGGCAAATTGATAAGAATGTATATGTAAACTGTGCTCTTCGCTTTCT
JMFF047H08+ CAAAATTGGGAGAGGGCAAATTGATAAGAATGTATATGTAAACTGTGCTCTTCGCTTTCT
                      ____________________________________________________________
consensus CAAAATTGGGAGAGGGCAAATTGATAAGAATGTATATGTAAACTGTGCTCTTCGCTTTCT
 
. : . : . : . : . : . :
JMSF044O05+ ACGAAGAGAAAGAGACGAAAGGGGAGGACTAGACGC
JMFS009F09+ ACGAAGAGAAAGAGACGAAAGGGGAGGACTAGACGCAAGATTTTTCACTTTTTTT
JMFF047H08+ ACGAAGAGAAAGAGACGAAAGGGGAGGACTAGACGCAAGATTTTTCACTTTTTTTTCCTC
                      ____________________________________________________________
consensus ACGAAGAGAAAGAGACGAAAGGGGAGGACTAGACGCAAGATTTTTCACTTTTTTTTCCTC