Previous Contig 002019:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002I04Sequence310002019 (28)gb:AF104392_17682543e-05Cucumis sativus extensin-like protein (EXTL) mRNA, partial cds.112001903 (22)
JMFF008O24Sequence570002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFF025D03Sequence567002019 (28)pir|AH2156|AH21563e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000832002019 (28)pir|G84494|G844944e-27hypothetical protein At2g10940 [imported] - Arabidopsis thaliana>gb:AC006429_153
JMFF042D17Sequence606002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFF044D17Sequence632002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000420001903 (22)gb:AF104392_17682542e-16Cucumis sativus extensin-like protein (EXTL) mRNA, partial cds.
JMFF045O17Sequence631002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000554001903 (22)pir|G84494|G844942e-27hypothetical protein At2g10940 [imported] - Arabidopsis thaliana>gb:AC006429_153
JMFF047H02Sequence635002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000308001903 (22)
JMFF048D21Sequence381002019 (28)gb:AF104392_17682543e-05Cucumis sativus extensin-like protein (EXTL) mRNA, partial cds.192001903 (22)
JMFN004B03Sequence627002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN007J05Sequence625002019 (28)pir|T14313|T143132e-08hypothetical protein - carrot>gb:AB000505_1508372 Carrot mRNA for hypocotil spec
JMFN007O10Sequence616002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN010C09Sequence679002019 (28)pir|G84494|G844942e-13hypothetical protein At2g10940 [imported] - Arabidopsis thaliana>gb:AC006429_153
JMFN010E09Sequence625002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN031C02Sequence607002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN031G21Sequence622002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN035O08Sequence629002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN039D06Sequence622002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFN042L18Sequence405002019 (28)pir|AH2156|AH21561e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS005H10Sequence529002019 (28)pir|AH2156|AH21561e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS029B05Sequence627002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS040E12Sequence626002019 (28)pir|T14313|T143135e-13hypothetical protein - carrot>gb:AB000505_1508372 Carrot mRNA for hypocotil spec
JMFS060B12Sequence627002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS060F02Sequence627002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS063F11Sequence619002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS064C12Sequence627002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS075A06Sequence619002019 (28)pir|AH2156|AH21562e-06hypothetical protein alr2807 [imported] - Nostoc sp. (strain PCC 7120)>gb:BA0000
JMFS075F03Sequence312002019 (28)gb:AF104392_17682542e-04Cucumis sativus extensin-like protein (EXTL) mRNA, partial cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF025D03- ATTGAAATAAATAAAACAAATAAAATTAACATTAACATTACACATGAAATAAAATTAC
                      ____________________________________________________________
consensus ATTGAAATAAATAAAACAAATAAAATTAACATTAACATTACACATGAAATAAAATTAC
 
. : . : . : . : . : . :
rJMFF025D03- CATCAATAAATTGCTGTTCAAATAAACCCAAAGATGCATAACTTCAATCCACACTATAGA
                      ____________________________________________________________
consensus CATCAATAAATTGCTGTTCAAATAAACCCAAAGATGCATAACTTCAATCCACACTATAGA
 
. : . : . : . : . : . :
rJMFF025D03- GAAAGAGATACTAAGGGGTGGGAGTGGAATCATGAAGAAAGAAATCATAGGCTCGACATC
                      ____________________________________________________________
consensus GAAAGAGATACTAAGGGGTGGGAGTGGAATCATGAAGAAAGAAATCATAGGCTCGACATC
 
. : . : . : . : . : . :
rJMFF025D03- CTTTCATGTCAATCCATCAAATCTACAGCTTAGACCCTTAGTGGTAGGGTGGTTTAGAGA
                      ____________________________________________________________
consensus CTTTCATGTCAATCCATCAAATCTACAGCTTAGACCCTTAGTGGTAGGGTGGTTTAGAGA
 
. : . : . : . : . : . :
rJMFF025D03- GCGCAAGTGTATCCAGGAGGAGGAGTCTTGCCGCAGGTGACGAGGAGCTGAAGAGCGAGC
                      ____________________________________________________________
consensus GCGCAAGTGTATCCAGGAGGAGGAGTCTTGCCGCAGGTGACGAGGAGCTGAAGAGCGAGC
 
. : . : . : . : . : . :
rJMFF025D03- GGAACGTAAATGCTGAGGTTGAGAGCCTTAATCTTCAAGGTTGTGCACAGGCAAGCCGCG
JMFN007J05+ ACAGGCAAGCCGCG
JMFN010C09+ AAATGCTGAGGTGNAGAGCCTTAATCTTCAAGGTTGTGCACAGGCAAGCCGCG
                      ____________________________________________________________
consensus GGAACGTAAATGCTGAGGTTGAGAGCCTTAATCTTCAAGGTTGTGCACAGGCAAGCCGCG
 
. : . : . : . : . : . :
rJMFF025D03- GCTTCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN007J05+ GCTTCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS075A06+ TTCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS063F11+ TCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN010C09+ GCTTCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN010E09+ TCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS029B05+ GAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS064C12+ CAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS060B12+ CAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS060F02+ CAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN035O08+ AACCAGCCC-TTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN031G21+ TTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFS040E12+ GCCCTTTAAGAATGGGGCAGCATTCATTCACGNCGGGGTCGCCG
JMFN004B03+ AGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN039D06+ TTAAGAATGGGGCAGCA-TCATTCACGGCGG-GTCGCCG
JMFN007O10+ GAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFN031C02+ AGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFF042D17+ CGGCGGGGTCGCCG
JMFF044D17+ AGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
JMFF045O17+ GAATGGGGCAGCATTCATTCACGGCGGNGTCGCCG
JMFF047H02+ GAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
                      ____________________________________________________________
consensus GCTTCGAGCTCAACCAGCCCTTTAAGAATGGGGCAGCATTCATTCACGGCGGGGTCGCCG
 
. : . : . : . : . : . :
rJMFF025D03- AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN007J05+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS075A06+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS063F11+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN010C09+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN010E09+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS029B05+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS064C12+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS060B12+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS060F02+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN035O08+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN031G21+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS040E12+ AGCCCGACGTGAATCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN004B03+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN039D06+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN007O10+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFN031C02+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFF042D17+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFF044D17+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFF045O17+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFF025D03+ GTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFS005H10+ CGCACGCGCCGAGCTNCAGGGTGTCA
JMFF008O24+ GTCCACGCACGCGCCGAGCTTCAGGGTGTCA
JMFF047H02+ AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
                      ____________________________________________________________
consensus AGCCCGACGTGAACCAGGCCTCCGAGAAGGTCCACGCACGCGCCGAGCTTCAGGGTGTCA
 
. : . : . : . : . : . :
rJMFF025D03- ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN007J05+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS075A06+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS063F11+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN010C09+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN010E09+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS029B05+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS064C12+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS060B12+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS060F02+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN035O08+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN031G21+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS040E12+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN004B03+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN039D06+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN007O10+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFN031C02+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFF042D17+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFF044D17+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFF045O17+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFF025D03+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFS005H10+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFF008O24+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
JMFF047H02+ ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
                      ____________________________________________________________
consensus ATGGGGCAGGTCGCCGCCGCCGGTGGGCAGGGCTTGGCCGGCCCGGGAGTGACCGGAGTG
 
. : . : . : . : . : . :
rJMFF025D03- ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN007J05+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS075A06+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS063F11+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN010C09+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN010E09+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS029B05+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS064C12+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS060B12+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS060F02+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN035O08+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN031G21+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS040E12+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN004B03+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN039D06+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN007O10+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN031C02+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFF042D17+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFF044D17+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFF045O17+ ACCACCGGAGGCAGAGTGATNGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFF025D03+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFS005H10+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFN042L18+ TGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFF008O24+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
JMFF047H02+ ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCAGCACTGGTGGGAGG
                      ____________________________________________________________
consensus ACCACCGGAGGCAGAGTGATTGGAGGGACGGTAACTGGGGGCTTCACCACTGGTGGGAGG
 
. : . : . : . : . : . :
rJMFF025D03- GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN007J05+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS075A06+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS063F11+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN010C09+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN010E09+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS029B05+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS064C12+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS060B12+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS060F02+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN035O08+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN031G21+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS040E12+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN004B03+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN039D06+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN007O10+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN031C02+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF042D17+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF044D17+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF045O17+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF025D03+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFS005H10+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFN042L18+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF048D21+ CCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF008O24+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
JMFF047H02+ GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
                      ____________________________________________________________
consensus GTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGCGGGAGTGTAATCGGAGGAACG
 
. : . : . : . : . : . :
rJMFF025D03- GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN007J05+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS075A06+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS063F11+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN010C09+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN010E09+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS029B05+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS064C12+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS060B12+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS060F02+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN035O08+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN031G21+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS040E12+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN004B03+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN039D06+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN007O10+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN031C02+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFF042D17+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFF044D17+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFF045O17+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFF025D03+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS005H10+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFN042L18+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFF048D21+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFS075F03+ GTAATCGGAGGGATGGGAACTGTGGGCTTG
JMFF008O24+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
JMFF002I04+ CTGGGGGCTNG
JMFF047H02+ GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
                      ____________________________________________________________
consensus GTAACTGGGGGCTTGACCACCGGGGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTG
 
. : . : . : . : . : . :
rJMFF025D03- ACGACCGGCGGGAGTGTAATCGGAGGGAANGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN007J05+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS075A06+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS063F11+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN010C09+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN010E09+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS029B05+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS064C12+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS060B12+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS060F02+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN035O08+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN031G21+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS040E12+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN004B03+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN039D06+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN007O10+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN031C02+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF042D17+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF044D17+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF045O17+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF025D03+ ACGACCGGCGGGAGTGTAATCGGAGGGAAGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS005H10+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFN042L18+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF048D21+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFS075F03+ ACGACCGGCGGGAGTGTAATCGCAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF008O24+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF002I04+ ACGNCCGGCGNGANNGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
JMFF047H02+ ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
                      ____________________________________________________________
consensus ACGACCGGCGGGAGTGTAATCGGAGGGATGGGAACTGGGGGCTTGACCACCGGTGGGAGG
 
. : . : . : . : . : . :
rJMFF025D03- GTGATCGGCGGCACGGTAACGGGAGGNTTAACGACCGGTGGGAGGGTGACCGGA
JMFN007J05+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS075A06+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS063F11+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN010C09+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN010E09+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS029B05+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS064C12+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS060B12+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS060F02+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN035O08+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN031G21+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS040E12+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN004B03+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN039D06+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN007O10+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN031C02+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF042D17+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF044D17+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF045O17+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF025D03+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS005H10+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFN042L18+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF048D21+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFS075F03+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF008O24+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF002I04+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
JMFF047H02+ GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
                      ____________________________________________________________
consensus GTGATCGGCGGCACGGTAACGGGAGGTTTAACGACCGGTGGGAGGGTGACCGGAGGTTTA
 
. : . : . : . : . : . :
JMFN007J05+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS075A06+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS063F11+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN010C09+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN010E09+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS029B05+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS064C12+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS060B12+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS060F02+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN035O08+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN031G21+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS040E12+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN004B03+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN039D06+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN007O10+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN031C02+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF042D17+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF044D17+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF045O17+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF025D03+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS005H10+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFN042L18+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF048D21+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFS075F03+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGAATGGGCTTTCCGCAGGAG
JMFF008O24+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF002I04+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
JMFF047H02+ ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
                      ____________________________________________________________
consensus ATAGTAATTGGTGGCTTAGGGGTGGGCTTTTTGGGCTTGTGACTGGGCTTTCCGCAGGAG
 
. : . : . : . : . : . :
JMFN007J05+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS075A06+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS063F11+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN010C09+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN010E09+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS029B05+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS064C12+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS060B12+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS060F02+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN035O08+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN031G21+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS040E12+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN004B03+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN039D06+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN007O10+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN031C02+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF042D17+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF044D17+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF045O17+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF025D03+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS005H10+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFN042L18+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF048D21+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFS075F03+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF008O24+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF002I04+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
JMFF047H02+ CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
                      ____________________________________________________________
consensus CCACAGGCCAAAATGGGAGTGGCGGAGGAAATGAAAAGCATGGAAATGAGAAGAAGAGCG
 
. : . : . : . : . : . :
JMFN007J05+ GTTACCTTAGA
JMFS075A06+ GTTACCTTAGAGACCTCCATG
JMFS063F11+ GTTACCTTAGAGACCTCCATGG
JMFN010C09+ GTTACCTTAGAGACCTCCATGGTT
JMFN010E09+ GTTACCTTAGAGACCTCCATGGTTTAGT
JMFS029B05+ GTTACCTTAGAGACCTCCATGGTTTAGTGATG
JMFS064C12+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAA
JMFS060B12+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAA
JMFS060F02+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAA
JMFN035O08+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAA
JMFN031G21+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAA
JMFS040E12+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAG
JMFN004B03+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAG
JMFN039D06+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAA
JMFN007O10+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAA
JMFN031C02+ GTTACCTTAGAGACCTCCATGGTTTAGTGAT
JMFF042D17+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAA
JMFF044D17+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAAT
JMFF045O17+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAATGGT
JMFF025D03+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAATGGT
JMFS005H10+ GTTACCTTAGAGACCTCCATGGT
JMFN042L18+ GTTAC
JMFF048D21+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAA
JMFS075F03+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAG
JMFF008O24+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAATGGTGAT
JMFF002I04+ GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAATGGTGAT
JMFF047H02+ GTTACCTTAGAGACCTCCATGGTGTAGTGATGAAGAAGGAAGGAAGAGAGAATGGTGATC
                      ____________________________________________________________
consensus GTTACCTTAGAGACCTCCATGGTTTAGTGATGAAGAAGGAAGGAAGAGAGAATGGTGATC