Previous Contig 002018:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030A13Sequence299002018 (8)385010059 (7)
JMFF040A20Sequence471002018 (8)713010059 (7)
JMFF047G24Sequence376002018 (8)295010059 (7)
JMFS082A10Sequence617002018 (8)
JMFS082B06Sequence627002018 (8)gb:AF088280_17672650.002Arabidopsis thaliana phytochrome-associated protein 3 (PAP3) mRNA, complete cds.
JMSF012E08Sequence291002018 (8)747010059 (7)
JMSF029C05Sequence655002018 (8)gb:AF088280_17672656e-04Arabidopsis thaliana phytochrome-associated protein 3 (PAP3) mRNA, complete cds.644010059 (7)
JMSF048I11Sequence636002018 (8)653010059 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF030A13+ ATCCCAG
                      ____________________________________________________________
consensus ATCCCAG
 
. : . : . : . : . : . :
JMFF030A13+ GGATGGAANTGATGGGTGGTGAGCTTTATAAGNCCANGAAGGGAACAGCCCAAATCTATT
JMFS082B06+ CCCAAATCTATT
                      ____________________________________________________________
consensus GGATGGAANTGATGGGTGGTGAGCTTTATAAGNCCANGAAGGGAACAGCCCAAATCTATT
 
. : . : . : . : . : . :
JMFF030A13+ ATCATTTCTCGGTGATGAATTATTCACTGCCATCAGATTAGAACCATCTGTCTTATCCAT
JMFS082B06+ ATCATTTCTCGGTGATGAATTATTCACTGCCATCAGATTAGAACCATCTGTCTTATCCAT
                      ____________________________________________________________
consensus ATCATTTCTCGGTGATGAATTATTCACTGCCATCAGATTAGAACCATCTGTCTTATCCAT
 
. : . : . : . : . : . :
JMFF030A13+ CGAAACGAAATTATTTTGTGCAGGAAGTTCGTTTGNTGACAGACCAGATGCTTCAGGTAN
JMFS082B06+ CGAAACGAAATTATTTTGTGCAGGAAGTTCGTTTGCTGACAGACCAGATGCTTCAGGTAC
                      ____________________________________________________________
consensus CGAAACGAAATTATTTTGTGCAGGAAGTTCGTTTGCTGACAGACCAGATGCTTCAGGTAC
 
. : . : . : . : . : . :
JMFF030A13+ TACTCCAGAACTATATTCATACTGCAGACTATTGTTATTTAGCGAGTAATTTAACCAAGG
JMFS082B06+ TACTCCAGAACTATATTCATACTGCAGACTATTGTTATTTAGCGAGTAATTTAACCAAGG
JMSF029C05+ TGCAGACTATTGNTATTTAGCGAGTAATTTAACCAAGG
                      ____________________________________________________________
consensus TACTCCAGAACTATATTCATACTGCAGACTATTGTTATTTAGCGAGTAATTTAACCAAGG
 
. : . : . : . : . : . :
JMFF030A13+ CACAATCTCGTCATCCTGGCTCAAATCCATTTCATTGGTGGGTACA
JMFS082B06+ CACAATCTCGTCATCCTGGCTCAAATCCATTTCATTGGTGGGTACAGATAACGCCATTTC
JMSF029C05+ CACAATCTCGTCATCCNGGCTCAAATCCATTTCATTGGTGGGTACAGATAACGCCATTTC
JMFS082A10+ CGTCATCCTGGCTCAAATCCATTTCATTGGTGGGTACAGATAACGCCATTTC
JMSF048I11+ GGCTCAAATCCATTTCATTGGTGGGTACAGATAACGCCATTTC
                      ____________________________________________________________
consensus CACAATCTCGTCATCCTGGCTCAAATCCATTTCATTGGTGGGTACAGATAACGCCATTTC
 
. : . : . : . : . : . :
JMFS082B06+ ATCCATTAAAAACGCCTTTCCTCGGATCCCCCGGGAGGAGGGATTTTCTTTAGGCTTGTC
JMSF029C05+ ATCCATTAAAAACTCCTTTCCTCGGATCCCCCGGGAGGAGGGATTTTCTTTAGGCTTGTC
JMFS082A10+ ATCCATTAAAAACGCCTTTCCTCGGATCCCCCGGGAGGAGGGATTTTCTTTAGGCTTGTC
JMSF048I11+ ATCCATTAAAAACGCCTTTCCTCGGATCCCCCGGGAGGAGGGATTTTCTTTAGGCTTGTC
                      ____________________________________________________________
consensus ATCCATTAAAAACGCCTTTCCTCGGATCCCCCGGGAGGAGGGATTTTCTTTAGGCTTGTC
 
. : . : . : . : . : . :
JMFS082B06+ TCGAATCACGGGCATTTCCGAGGATAGATTGTTAGAAGTAGGATTCCTCTTACCTCTGCT
JMSF029C05+ TCGAATCACGGGCATTTCCGAGGATAGATTGTTAGAAGTAGGATTCCTCTTACCTCTGCT
JMFF040A20+ CGAATCACGGGCATTTCCGAGGATAGATTGTTAGAAGTAGGATTCCTCTTACCTCTGCT
JMFS082A10+ TCGAATCACGGGCATTTCCGAGGATAGATTGTTAGAAGTAGGATTCCTCTTACCTCTGCT
JMSF048I11+ TCGAATCACGGGCATTTCCGAGGATAGATTGTTAGAAGTAGGATTCCTCTTACCTCTGCT
                      ____________________________________________________________
consensus TCGAATCACGGGCATTTCCGAGGATAGATTGTTAGAAGTAGGATTCCTCTTACCTCTGCT
 
. : . : . : . : . : . :
JMFS082B06+ CGACTGACCTTGCATAACAATCTGGCCATTTTCCCATACTAGCTCAACCACTTCATTTTC
JMSF029C05+ CGACTGACCTTGCATAACAATCTGGCCATTTTCCCATACTAGCTCAACCACTTCATTTTC
JMFF040A20+ CGACTGACCTTGCATAACAATCTGGCCATTTTCCCATACTAGCTCAACCACTTCATTTTC
JMFS082A10+ CGACTGACCTTGCATAACAATCTGGCCATTTTCCCATACTAGCTCAACCACTTCATTTTC
JMSF048I11+ CGACTGACCTTGCATAACAATCTGGCCATTTTCCCATACTAGCTCAACCACTTCATTTTC
                      ____________________________________________________________
consensus CGACTGACCTTGCATAACAATCTGGCCATTTTCCCATACTAGCTCAACCACTTCATTTTC
 
. : . : . : . : . : . :
JMFS082B06+ TAAAAAATCGGGCGAAGATGAAGCTGTTTTTGGCTCCCCAAACTCAAGATTATGCAACTT
JMSF029C05+ TAAAAAATCGGGCGAAGATGAAGCTGTTTTTGGCTCCCCAAACTCAAGATTATGCAACTT
JMFF040A20+ TAAAAAATCGGGCGAAGATGAAGCTGTTTTTGGCTCCCCAAACTCAAGATTATGCAACTT
JMFS082A10+ TAAAAAATCGGGCGAAGATGAAGCTGTTTTTGGCTCCCCAAACTCAAGATTATGCAACTT
JMSF048I11+ TAAAAAATCGGGCGAAGATGAAGCTGTTTTTGGCTCCCCAAACTCAAGATTATGCAACTT
JMFF047G24+ CAAGATTATGCACTTT
                      ____________________________________________________________
consensus TAAAAAATCGGGCGAAGATGAAGCTGTTTTTGGCTCCCCAAACTCAAGATTATGCAACTT
 
. : . : . : . : . : . :
JMFS082B06+ CAAAAACTCAGAGAGAGGCATGGTGGAAAGGTGAATAATCACTGCACAAAACTTCCCTTC
JMSF029C05+ CAAAAACTCAGAGAGAGGCATGGTGGAAAGGTGAATAATCACTGCACAAAACTTCCCTTC
JMFF040A20+ CAAAAACTCAGAGAGAGGCATGGTGGAAAGGTGAATAATCACTGCACAAAACTTCCCTTC
JMFS082A10+ CAAAAACTCAGAGAGAGGCATGGTGGAAAGGTGAATAATCACTGCACAAAACTTCCCTTC
JMSF048I11+ CAAAAACTCAGAGAGAGGCATGGTGGAAAGGTGAATAATCACTGCACAAAACTTCCCTTC
JMFF047G24+ CAAAAACTCAGAGAGAGGCATGGTGGAAGGGTGAATAATCACTGCACAAAACTTCCCTTC
                      ____________________________________________________________
consensus CAAAAACTCAGAGAGAGGCATGGTGGAAAGGTGAATAATCACTGCACAAAACTTCCCTTC
 
. : . : . : . : . : . :
JMFS082B06+ ACTTCAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
JMSF029C05+ ACTTCAGCCATTATTNGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
JMFF040A20+ ACTTCAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
JMFS082A10+ ACTTCAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
JMSF048I11+ ACTTCAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
JMSF012E08+ CAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
JMFF047G24+ ACTTCAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
                      ____________________________________________________________
consensus ACTTCAGCCATTATTTGCTGTCTTCTTCAATGCTATCTTTTCTTTCTTTCTAATAATAGC
 
. : . : . : . : . : . :
JMFS082B06+ T
JMSF029C05+ TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
JMFF040A20+ TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
JMFS082A10+ TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
JMSF048I11+ TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
JMSF012E08+ TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
JMFF047G24+ TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
                      ____________________________________________________________
consensus TCTTAAACATCATCAAAAAAGCAACTCAAGCTCCAATACCACCTCCAGTAGATGCAATCT
 
. : . : . : . : . : . :
JMSF029C05+ TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
JMFF040A20+ TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
JMFS082A10+ TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
JMSF048I11+ TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
JMSF012E08+ TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
JMFF047G24+ TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
                      ____________________________________________________________
consensus TTTCAAGATTTCCACTGCACTGTATCAGTAATAATTTTTTATTTTATTTTATTATTATAC
 
. : . : . : . : . : . :
JMSF029C05+ TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATGTTTTTCTAGCTTTCC
JMFF040A20+ TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATGTTT
JMFS082A10+ TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATGTTTTTCTAGCTTTCC
JMSF048I11+ TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATG--TTTCTAGCTTTCC
JMSF012E08+ TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATGTTTTTCTAGCTTTCC
JMFF047G24+ TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATGTTTTTCTAGCTTTCC
                      ____________________________________________________________
consensus TAATTATTATTTGAAATTCACCAACAACAAGTGGCATTCCACATGTTTTTCTAGCTTTCC
 
. : . : . : . : . : . :
JMSF029C05+ CAAAAAAGAGGAGTGC
JMFS082A10+ CAAAAAAGAGGAGTGCAAGTTTTAG
JMSF048I11+ CAAAAAAGAGGAGTGCAAGTTTTAGAGCTCCAAGAAGAGAAGAAAAAAATATG
JMSF012E08+ CAAAAAAGAGGAGTGCAAGTTTTAGAGCTCCAAGAAGAGAAGAAAAAAATATG
JMFF047G24+ CAAAAAAGAGGAGTGCAAGTTTTAGAGCTCCAAGAAGAGAAGAAAAAAATATGTATTCTC
                      ____________________________________________________________
consensus CAAAAAAGAGGAGTGCAAGTTTTAGAGCTCCAAGAAGAGAAGAAAAAAATATGTATTCTC