Previous Contig 002003:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046O19Sequence623002003 (3)gb:AF070967_17657714e-40Nicotiana clevelandii SKP1-like protein mRNA, complete cds.578002003 (3)gb:AF070967_17657714e-43Nicotiana clevelandii SKP1-like protein mRNA, complete cds.
JMFN025A13Sequence544002003 (3)gb:AF070967_17657717e-46Nicotiana clevelandii SKP1-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046O19- AAGAA
                      ____________________________________________________________
consensus AAGAA
 
. : . : . : . : . : . :
rJMFF046O19- AAGGGTATCACATACATTATATTATTATGATAACAAAGAGGATTTATTAGTAGGATACAT
JMFF046O19+ TTAGTAGGATACAT
                      ____________________________________________________________
consensus AAGGGTATCACATACATTATATTATTATGATAACAAAGAGGATTTATTAGTAGGATACAT
 
. : . : . : . : . : . :
rJMFF046O19- GCATAGCAAACCACCATTAAAGCAAGCAAACAGGCAATTAACAGAATTGAAATTTTACTC
JMFN025A13+ TTCACTC
JMFF046O19+ GCATAGCAAACCACCATTAAAGCAAGCAAACAGGCAATTAACAGAATTGAAATNTTACTC
                      ____________________________________________________________
consensus GCATAGCAAACCACCATTAAAGCAAGCAAACAGGCAATTAACAGAATTGAAATTTTACTC
 
. : . : . : . : . : . :
rJMFF046O19- AAATGCCCAAGCATTCTCCCTAGGGATCTCCTCTTCTTCTTCCTCTGGTGTGAAGGCAGT
JMFN025A13+ ATATGCCCAAGCATTCTCCCTACGGAT---CTCTTCTTCTTCCTCTGGTGTGAAGGCAGT
JMFF046O19+ AAATGCCCAAGCATTCTCCCTAGGGATCTCCTCTTCTTCTTCCTCTGGTGTGAAGGCAGT
                      ____________________________________________________________
consensus AAATGCCCAAGCATTCTCCCTAGGGATCTCCTCTTCTTCTTCCTCTGGTGTGAAGGCAGT
 
. : . : . : . : . : . :
rJMFF046O19- TTGGATATTGAGAACTTTGCTCATCTCCTCTGGTGTCTTCCCCGTGATCATATCAGCAAT
JMFN025A13+ TTGGATATTGAAAATTTTGCTGATCTCCTCTGGTGTCTTCCCCTTGATCATATCAGCAAC
JMFF046O19+ TTGGATATTGAGAACTTTGCTCATCTCCTCTGGTGTCTTCCCCGTGATCATATCAGCAAT
                      ____________________________________________________________
consensus TTGGATATTGAGAACTTTGCTCATCTCCTCTGGTGTCTTCCCCGTGATCATATCAGCAAT
 
. : . : . : . : . : . :
rJMFF046O19- AGTTTGACAGATAAGATCAAGCAAGCTATTGATGTTGAGGAAATTAGCAGCCTCGACGAG
JMFN025A13+ AGTTTGACAGGTAAGATCAAGCAAACTATTGATGTTGAGGAAATTAGCAGCTAGAACAAG
JMFF046O19+ AGTTTGACAGATAAGATCAAGCAAGCTATTGATGTTGAGGAAATTAGCAGCCTCGACGAG
                      ____________________________________________________________
consensus AGTTTGACAGATAAGATCAAGCAAGCTATTGATGTTGAGGAAATTAGCAGCCTCGACGAG
 
. : . : . : . : . : . :
rJMFF046O19- ATCAAACAAAATTGTTTGGTCAACTTCGACGAAATTAGCATCGAAGGCCTTGAGATTGTC
JMFN025A13+ ATCAAACAACGTTTTGTGGTCAACTTTGATGAAATTAGCATCGAAGGCCTTGAGATCGTC
JMFF046O19+ ATCAAACAAAATTGTTTGGTCAACTTCGACGAAATTAGCATCGAAGGCCTTGAGATTGTC
                      ____________________________________________________________
consensus ATCAAACAAAATTGTTTGGTCAACTTCGACGAAATTAGCATCGAAGGCCTTGAGATTGTC
 
. : . : . : . : . : . :
rJMFF046O19- GGAATCAATGGTCCCCTTGGCGGCCTCGGCGTGGCATTTGCAGTAGTCTATAACCATGTC
JMFN025A13+ GGAATCAATGGTCCCCTTCGCGGCCTCAACGTGGCATTTGCAGTAGTCTATAACCATGCC
JMFF046O19+ GGAATCAATGGTCCCCTTGGCGGCCTCGGCGTGGCATTTGCAGTAGTCTATAACCATGTC
                      ____________________________________________________________
consensus GGAATCAATGGTCCCCTTGGCGGCCTCGGCGTGGCATTTGCAGTAGTCTATAACCATGTC
 
. : . : . : . : . : . :
rJMFF046O19- TAAGATCTTGCTAGTTACCATAGGGACGGGGATGGTAATAGTGATGTCATCGTTATCCAC
JMFN025A13+ TAAGATCTTGCTAGTTACATTAGGGACGGGGATGGTGATGGTGGTGTCATCGTTGTCCAC
JMFF046O19+ TAAGATCTTGCTAGTTACCATAGGGACGGGGATGGTAATAGTGATGTCATCGTTATCCAC
                      ____________________________________________________________
consensus TAAGATCTTGCTAGTTACCATAGGGACGGGGATGGTAATAGTGATGTCATCGTTATCCAC
 
. : . : . : . : . : . :
rJMFF046O19- AATCATGTACTTGAGTACCTGCGACTNCAGCGCCACCTCCTCATCCACCTTGAAGATCTC
JMFN025A13+ AATCATGTACTTGAGCATTTGTGACTTGAGCGCCACCGCCTCCTCCACCTCGAAGATCTC
JMFF046O19+ AATCATGTACTTGAGTACCTGCGACTCAAGCGCCACCTCCTCATCCACCTTGAAGATCTC
                      ____________________________________________________________
consensus AATCATGTACTTGAGTACCTGCGACTTGAGCGCCACCTCCTCATCCACCTTGAAGATCTC
 
. : . : . : . : . : . :
rJMFF046O19- TCCGTCGGAACTCTTCAAAATGATCATCTTTGA
JMFN025A13+ TCCGTC
JMFF046O19+ TCCGTCGGAACTCTTCAAAATGATCATCTTTGAGGAAGACATCGGAACTTAGTAGGATGA
                      ____________________________________________________________
consensus TCCGTCGGAACTCTTCAAAATGATCATCTTTGAGGAAGACATCGGAACTTAGTAGGATGA
 
. : . : . : . : . : . :
JMFF046O19+ AATTTGGGAAAAAACCAAAGGGAATTTAACAAAGCAAAAAGAGCAAAGAAACCTATTATT
                      ____________________________________________________________
consensus AATTTGGGAAAAAACCAAAGGGAATTTAACAAAGCAAAAAGAGCAAAGAAACCTATTATT