Previous Contig 001996:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046M18Sequence562001996 (10)pir|T49208|T492082e-15hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi335001996 (10)gb:AP004366_18408457e-05Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046
JMFN025B01Sequence633001996 (10)pir|T49208|T492082e-34hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi
JMFS077B06Sequence621001996 (10)pir|T49208|T492087e-34hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi
JMSF033N02Sequence683001996 (10)pir|T49208|T492083e-39hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi676001996 (10)gb:AP004366_18408452e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046
JMSF044F24Sequence825001996 (10)pir|T49208|T492083e-66hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi728001996 (10)gb:AP004366_18408452e-82Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046
JMSF048A07Sequence699001996 (10)pir|T49208|T492082e-35hypothetical protein F27K19.140 - Arabidopsis thaliana>gb:ATF27K19_1550241 Arabi735001996 (10)gb:AP004366_18408453e-55Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P046

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046M18- CAA
                      ____________________________________________________________
consensus CAA
 
. : . : . : . : . : . :
rJMFF046M18- TTTGTGGAAGTGATTATTGCCTATATAAGGATGXXXXXXXXXXXXXXXXXXXXXXXXXAC
                      ____________________________________________________________
consensus TTTGTGGAAGTGATTATTGCCTATATAAGGATGNNNNNNNNNNNNNNNNNNNNNNNNNAC
 
. : . : . : . : . : . :
rJMFF046M18- AATAGTAGGGGACATACAAGAAAGCCCAATGACATTGGAAGAAAATAAAACTATAGACAT
rJMSF033N02- ACTATAGACAT
rJMSF044F24- ACTATAGACAT
rJMSF048A07- ACTATAGACAT
                      ____________________________________________________________
consensus AATAGTAGGGGACATACAAGAAAGCCCAATGACATTGGAAGAAAATAAAACTATAGACAT
 
. : . : . : . : . : . :
rJMFF046M18- AGTTATACAAGAATCTGAGTGACAATCACAATTGTGCCACAG-ACCAAACAGACCTGCAT
rJMSF033N02- AGTTATACAAGAATCTGAGTGACAATCACAATTGTGCCACAG-ACCAGACAGACCTGCAT
rJMSF044F24- AGTTATACNAGANTCTGAGTGACAATCACAATTGTGCCACAGTACCAGACAGACCTGCAT
rJMSF048A07- AGTTATACAAGAATCNGAGTGACAATCANAATTGTGCCANAG-ACCAGACAGACCTGCAT
                      ____________________________________________________________
consensus AGTTATACAAGAATCTGAGTGACAATCACAATTGTGCCACAG-ACCAGACAGACCTGCAT
 
. : . : . : . : . : . :
rJMFF046M18- TCATCAATCAATCCAAGATGTCTGCTACTCAAAACCTTAGGATGCATAATCTCATCCTGC
rJMSF033N02- TCATCAATCAATCCAAGATGTCTGCTACTCAAAACCTTAGGATGCATAATCTCATCCTGC
rJMSF044F24- TCATCAATCAATCCAAGATGTCTGCTACTCAAAACCTTAGGATGCATAATCTCATCCTGC
rJMSF048A07- TCATCAATCAATCCAAGATGTCTGCTACTCAAAACCTTAGGATGCATAATCTCATCCTGC
                      ____________________________________________________________
consensus TCATCAATCAATCCAAGATGTCTGCTACTCAAAACCTTAGGATGCATAATCTCATCCTGC
 
. : . : . : . : . : . :
rJMFF046M18- ATTCATCAACCCAGAAGCTGGGATTCCTTGTTTCTTAAACCATTCAGGCATATGAAATTT
rJMSF033N02- ATTCATCAACCCAGAAGCTGGGATTCCTTGTTTCTTAAACCATTCAGGCATATGAAATTT
rJMSF044F24- ATTCATCAACCCAGAAGCTGGGATTCCTTGTTTCTTAAACCATTCAGGCATATGAAATTT
rJMSF048A07- ATTCATCAACCCAGAAGCTGGGATTCCTTGTTTCTTAAACCATTCAGGCATATGAAATTT
                      ____________________________________________________________
consensus ATTCATCAACCCAGAAGCTGGGATTCCTTGTTTCTTAAACCATTCAGGCATATGAAATTT
 
. : . : . : . : . : . :
rJMFF046M18- TTCGTAGAGTGCCAGTCTGACATCCTTCTGTTG
rJMSF033N02- TTCGTAGAGTGCCAGTCTGACATCCTTCTGTTGAGAGAGGTGGTTCAGAAGAGGAAGTAT
rJMSF044F24- TTCGTAGAGTGCCAGTCTGACATCCTTCTGTTGAGAGAGGTGGTTCAGAAGAGGAAGTAT
rJMSF048A07- TTCGTAGAGTGCCAGTCTGACATCCTTCTGTTGAGAGAGGTGGTTCAGAAGAGGAAGTAT
                      ____________________________________________________________
consensus TTCGTAGAGTGCCAGTCTGACATCCTTCTGTTGAGAGAGGTGGTTCAGAAGAGGAAGTAT
 
. : . : . : . : . : . :
rJMSF033N02- GACTTCCAGGAGCTGATGGTCATGCGGTTGCCCGGGAGAGAATGGAATGCAAGGAAT-CC
rJMSF044F24- GACTTCCAGGAGCTGATGGTCATGCGGTTGCCCGGGAGAGAATGGAATGCAAGGAAT-CC
rJMSF048A07- GACTTCCAGGAGCTGATGGTCATGCGGTTGCCCGGGAGAGAATGGAATGCAAGGAAT-CC
JMSF044F24+ CCCGGGAGAGAATGGAATGCAAGGAATNCC
                      ____________________________________________________________
consensus GACTTCCAGGAGCTGATGGTCATGCGGTTGCCCGGGAGAGAATGGAATGCAAGGAAT-CC
 
. : . : . : . : . : . :
rJMSF033N02- CATTTAGTGGTTGCAGCAAGAAACTAAAAGGG-TTGTTATCAACAATAACAATTCTGCAT
rJMSF044F24- CATTTAGTGGTTGCAGCAAGAAACTAAAAGGG-TTGTTATCAACAATAACAATTCTGCAT
rJMSF048A07- CATTTAGTGGTTGCAGCAAGAAACTAAAAGGG-TTGTTATCAACAATAACAATTCTGCAT
JMSF044F24+ CATTTAGTGGTTGCAGCAAGAAACTAAAAGGGNTTGTTATCAACAATAACAATTCTGCAT
                      ____________________________________________________________
consensus CATTTAGTGGTTGCAGCAAGAAACTAAAAGGG-TTGTTATCAACAATAACAATTCTGCAT
 
. : . : . : . : . : . :
rJMSF033N02- AAATCCTTCGATATGCTACACAGATCCTTCACGTGTTCTCGGTATTCCGTCCTGGTTGTA
rJMSF044F24- AAATCCTTCGATATGCTACACAGATCCTTCACGTGTTCTCGGTATTCCGTCCTGGTTGTA
rJMSF048A07- AAATCCTCCGATATGCTACACAGATCCTTCACGTGTTCTCGGTATTCCGTCCTGGTTGTA
JMSF044F24+ AAATCCTTCGATATGCTACACAGATCCTTCACGTGTTCTCGGTATTCCGTCCTGGTTGTA
                      ____________________________________________________________
consensus AAATCCTTCGATATGCTACACAGATCCTTCACGTGTTCTCGGTATTCCGTCCTGGTTGTA
 
. : . : . : . : . : . :
rJMSF033N02- GAAGGCCTGTATAGTCTAAGAATGAATCGATTTTCAGTATCGATTTTGTCAACAAGGGGC
rJMSF044F24- GAAGGCCTGTATAGTCTAAGAATGAATCGATTTTCAGTATCGATTTTGTCAACAAGGGGC
rJMSF048A07- GAAGGCCTGTATAGTCTAAGAATGAATCGATTTTCAGTATCGATTTTGTCAACAAGGGGC
JMSF044F24+ GAAGGCCTGTATAGTCTAAGAATGAATCGATTTTCAGTATCGATTTTGTCAACAAGGGGC
                      ____________________________________________________________
consensus GAAGGCCTGTATAGTCTAAGAATGAATCGATTTTCAGTATCGATTTTGTCAACAAGGGGC
 
. : . : . : . : . : . :
rJMSF033N02- CTCGCATAGCCTTCAAGCCCTGCAGTAAACAACACAAGGTCAGC-AAACTCGCTAAGTTG
rJMSF044F24- CTCGCATAGCCTTCAAGCCCTGCAGTAAACAACACAAGGTCAGC-AAACTCGCTAAGTTG
rJMSF048A07- CTCGCATAGCCTTCAAGCCCTGCAGTAAACAACACAAGGTCAGCAAAACTCGCTAAGTTG
JMSF044F24+ CTCGCATAGCCTTCAAGCCCTGCAGTAAACAACACAAGGTCAGC-AAACTCGCTAAGTTG
JMFS077B06+ TAAGTTG
JMFN025B01+ TCGCTAAGTTG
JMSF033N02+ GCAGTAAACAACACAAGGTCAGC-AAACTCGCTAAGTTG
JMSF048A07+ TGCAGTAAACAACACAAGGTCAGCAAAACTCGCTAAGTTG
                      ____________________________________________________________
consensus CTCGCATAGCCTTCAAGCCCTGCAGTAAACAACACAAGGTCAGC-AAACTCGCTAAGTTG
 
. : . : . : . : . : . :
rJMSF033N02- TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
rJMSF044F24- TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
rJMSF048A07- TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
JMSF044F24+ TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
JMFS077B06+ TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
JMFN025B01+ TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
JMSF033N02+ TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
JMSF048A07+ TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
                      ____________________________________________________________
consensus TTTCAGAAATTGGCGAAGCCCGGGCCGTTCAAACACAGTCACATAGTTGATCTTAGGTTT
 
. : . : . : . : . : . :
rJMSF033N02- GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
rJMSF044F24- GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
rJMSF048A07- GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
JMSF044F24+ GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
JMFS077B06+ GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
JMFN025B01+ GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
JMSF033N02+ GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
JMSF048A07+ GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
JMFF046M18+ CAAACCAATCCAGCCCAGCNTC
                      ____________________________________________________________
consensus GCCATCACATTCCTTCTCTGAAGATATGCACTCTAGCTCAAACCAATCCAGCCCAGCCTC
 
. : . : . : . : . : . :
rJMSF033N02- AGTTGCC
rJMSF044F24- AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
rJMSF048A07- AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
JMSF044F24+ AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
JMFS077B06+ AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
JMFN025B01+ AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
JMSF033N02+ AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
JMSF048A07+ AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
JMFF046M18+ AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
                      ____________________________________________________________
consensus AGTTGCCTGAGTGCGTATTACAGGAGGCAAGCTCGATGTCTCATAAGCACAAACCAAAGT
 
. : . : . : . : . : . :
rJMSF048A07- TTCATCC
JMSF044F24+ TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
JMFS077B06+ TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
JMFN025B01+ TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
JMSF033N02+ TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
JMSF048A07+ TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
JMFF046M18+ TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
                      ____________________________________________________________
consensus TTCATCCAAGTCCAGAACAACCGTGAGTCTAGGCAGACGAAGCTCGTCGACGCTTCCAGC
 
. : . : . : . : . : . :
JMSF044F24+ GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
JMFS077B06+ GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
JMFN025B01+ GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
JMSF033N02+ GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
JMSF048A07+ GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
JMFF046M18+ GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
                      ____________________________________________________________
consensus GCCGATTTGCGCGGCGGAGGGCGGCGGCGCCTCCGCAGGCTCGTGAGACTCCGGGAGCTC
 
. : . : . : . : . : . :
JMSF044F24+ GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
JMFS077B06+ GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
JMFN025B01+ GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
JMSF033N02+ GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
JMSF048A07+ GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
JMFF046M18+ GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
                      ____________________________________________________________
consensus GACGACCGGGAGAGGCTTGAATTGCGGAGAGGGAGGGGAGAGGGAGGAGAAGAGCTGAGT
 
. : . : . : . : . : . :
JMSF044F24+ CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
JMFS077B06+ CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
JMFN025B01+ CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
JMSF033N02+ CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
JMSF048A07+ CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
JMFF046M18+ CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
                      ____________________________________________________________
consensus CAAAGACGGCGTGCCTCTGATGATCTGAACGAAGATCTGGAAGAAGAAGGCGAGCCAGTT
 
. : . : . : . : . : . :
JMSF044F24+ GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
JMFS077B06+ GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
JMFN025B01+ GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
JMSF033N02+ GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
JMSF048A07+ GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
JMFF046M18+ GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
                      ____________________________________________________________
consensus GAGGAGCGTCCGCCACACTTGCAGCGTCTTCGGGGCGTAAACTTCGGATGCCTGCGTGAG
 
. : . : . : . : . : . :
JMSF044F24+ CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGT
JMFS077B06+ CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGTGTGTG
JMFN025B01+ CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGTGTGTG
JMSF033N02+ CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGTGTGTG
JMSF048A07+ CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGTGTGTG
JMFF046M18+ CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGTGTGTG
                      ____________________________________________________________
consensus CTCCGCCATGAAAGTCGCCGGAGTGCTCCGCCTCTGGTGCGTACGCAGTTAGCGTGTGTG
 
. : . : . : . : . : . :
JMFS077B06+ CAGTGGCGAGTGACACAGTTATTTGGATTATTAATCGCAAACGAAATTGGAATTTTATTT
JMFN025B01+ CAGTGGCGAGTGACACAGTTATTTGGATTATTAATCGCAAACGAAATTGGAATTTTATTT
JMSF033N02+ CAGTGGCGAGTGACACAGTTATTTGGATTATTAATCGCAAACGAAATTGGAATTTTATTT
JMSF048A07+ CAGTGGCGAGTGACACAGTTATTTGGATTATTAATCGCAAACGAAATTGGAATTTTATTT
JMFF046M18+ CAGTGGCGAGTGACACAGTTATTTGGATTATTAATCGCAAACGAAAGTGGAATTTTATTT
                      ____________________________________________________________
consensus CAGTGGCGAGTGACACAGTTATTTGGATTATTAATCGCAAACGAAATTGGAATTTTATTT
 
. : . : . : . : . : . :
JMFS077B06+ TTCCATAATTTCTA
JMFN025B01+ TTCCATAATTTCTATGCTTTCC
JMSF033N02+ TTCCATAATTTCTATGCTTTCCCTCCCAATAATCTTTGATCATT
JMSF048A07+ TTCCATAATTTCTATGCTTTCCCTCCCAATAATCTTTGATCATTGGTCTGAGAACAA
JMFF046M18+ TTCCATAATTTCTATGCTTTCCCTCCCAATAATCTTTGATCATTGGTCTGAGAACAATAT
                      ____________________________________________________________
consensus TTCCATAATTTCTATGCTTTCCCTCCCAATAATCTTTGATCATTGGTCTGAGAACAATAT