Previous Contig 001994:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF017L22Sequence639001994 (4)
JMFF025H02Sequence515001994 (4)
JMFF046L14Sequence462001994 (4)514005305 (2)gb:AB105887_15266272e-38Glycine max Fan mRNA for microsomal omega-3 fatty acid desaturase, complete cds.
JMSF012E06Sequence560005305 (2)gb:AB105887_15266271e-66Glycine max Fan mRNA for microsomal omega-3 fatty acid desaturase, complete cds.699001994 (4)sp|P48626|FD3E_TOBAC3e-76Omega-3 fatty acid desaturase, endoplasmic reticulum (EC 1.14.19.-).>pir|JC2555|

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012E06+ CTGCTGGTCAACAATGGCTTCTCTTCTC
                      ____________________________________________________________
consensus CTGCTGGTCAACAATGGCTTCTCTTCTC
 
. : . : . : . : . : . :
rJMSF012E06+ GTTTATCTTTGCATCGTGTTTAGTCCACTCCTAGTTTTCAAGCTTTACGGTGTTCCCCTC
                      ____________________________________________________________
consensus GTTTATCTTTGCATCGTGTTTAGTCCACTCCTAGTTTTCAAGCTTTACGGTGTTCCCCTC
 
. : . : . : . : . : . :
rJMSF012E06+ TTGATTTTTGTCATGTGGTTGGATCTCGTCACCTACTTGCATCACCATGGTTACGATAAG
                      ____________________________________________________________
consensus TTGATTTTTGTCATGTGGTTGGATCTCGTCACCTACTTGCATCACCATGGTTACGATAAG
 
. : . : . : . : . : . :
rJMSF012E06+ AAGGTCCCGTGGTATCGTGGCAAGGAATGGAATTATTTGAGGGGAGGATTAACGACAATT
                      ____________________________________________________________
consensus AAGGTCCCGTGGTATCGTGGCAAGGAATGGAATTATTTGAGGGGAGGATTAACGACAATT
 
. : . : . : . : . : . :
rJMSF012E06+ GACCGTGATTATGGAATCATTAACAACATCCATCATGATATTGGCACCCATGTTATCCAC
                      ____________________________________________________________
consensus GACCGTGATTATGGAATCATTAACAACATCCATCATGATATTGGCACCCATGTTATCCAC
 
. : . : . : . : . : . :
rJMSF012E06+ CATTTGTTTCCCCAGATTCCCCACTATCATTTAATTGAAGCCACGAAAGCTGCGAAGCCG
                      ____________________________________________________________
consensus CATTTGTTTCCCCAGATTCCCCACTATCATTTAATTGAAGCCACGAAAGCTGCGAAGCCG
 
. : . : . : . : . : . :
rJMSF012E06+ GTGCTGGGGAAGTACTACAGGGAGCCGAAGAAGTCGGGGCTGATTCCGTTCCATCTCATT
                      ____________________________________________________________
consensus GTGCTGGGGAAGTACTACAGGGAGCCGAAGAAGTCGGGGCTGATTCCGTTCCATCTCATT
 
. : . : . : . : . : . :
rJMSF012E06+ CCCGTTCTGACAAAGAGCATGAGCGAGGATCACTATGTGAGCGACGAGGGGGAAGTCGTT
                      ____________________________________________________________
consensus CCCGTTCTGACAAAGAGCATGAGCGAGGATCACTATGTGAGCGACGAGGGGGAAGTCGTT
 
. : . : . : . : . : . :
rJMSF012E06+ TTCTACCAGACCGATAGAGATATAAGTTCTAAAAAGGACGCTTGAGAGATGGGGAGGCTC
                      ____________________________________________________________
consensus TTCTACCAGACCGATAGAGATATAAGTTCTAAAAAGGACGCTTGAGAGATGGGGAGGCTC
 
. : . : . : . : . : . :
rJMSF012E06+ TCTTCTTCTGGTTTTTTAGAGTGTATCTGTCAAAGACTAGAATTTCTGGCATATTGCCAT
JMFF017L22+ TTTTTAGAGTGTATCTGTCAAAGACTAGAATTTCTGGCATATTGCCAT
                      ____________________________________________________________
consensus TCTTCTTCTGGTTTTTTAGAGTGTATCTGTCAAAGACTAGAATTTCTGGCATATTGCCAT
 
. : . : . : . : . : . :
rJMSF012E06+ ATTTGGTGATAAATTTATCCCTAGTTATTACAGTAGAGAAGAGAAATGAAGAAGAAGCTT
JMFF017L22+ ATTTGGTGATAAATTTATCCCTAGTTATTACAGTAGAGAAGAGAAATGAAGAAGAAGCTT
                      ____________________________________________________________
consensus ATTTGGTGATAAATTTATCCCTAGTTATTACAGTAGAGAAGAGAAATGAAGAAGAAGCTT
 
. : . : . : . : . : . :
rJMSF012E06+ ATACAGTGTACTTTTGGGGCAAAAGAATGGGTGGTTTTGCCCATTCCAGGCCTCATCCAT
JMFF025H02+ GGGCAAAAGAATGGGTGGTTTTGCCCATTCCAGGCCTCATCCAT
JMFF017L22+ ATACAGTGTACTTTTGGGGCAAAAGAATGGGTGGTTTTGCCCATTCCAGGCCTCATCCAT
                      ____________________________________________________________
consensus ATACAGTGTACTTTTGGGGCAAAAGAATGGGTGGTTTTGCCCATTCCAGGCCTCATCCAT
 
. : . : . : . : . : . :
rJMSF012E06+ TGCAT
JMFF025H02+ TGCATTGAAATTTTGCTAATGGAATAAAAATGATTGATAATTATGAGTCTTCAAAGTCGT
JMFF017L22+ TGCATTGAAATTTTGCTAATGGAATAAAAATGATTGATAATTATGAGTCTTCAAAGTCGT
JMFF046L14+ GGAATAAAAATGATGNATAATTATGAGTCTTCAAAGTCGT
                      ____________________________________________________________
consensus TGCATTGAAATTTTGCTAATGGAATAAAAATGATTGATAATTATGAGTCTTCAAAGTCGT
 
. : . : . : . : . : . :
JMFF025H02+ TTTGTGGTGCAGAACAGTGGTAGCAGATACTCTAAATCTTGACAGTTTTAGTGTTCATCG
JMFF017L22+ TTTGTGGTGCAGAACAGTGGTAGCAGATACTCTAAATCTTGACAGTTTTAGTGTTCATCG
JMFF046L14+ TNTGTGGTGCAGAACAGTGGTAGCAGATACTCTAAATCTTGACAGTTTTAGTGTTCATCG
                      ____________________________________________________________
consensus TTTGTGGTGCAGAACAGTGGTAGCAGATACTCTAAATCTTGACAGTTTTAGTGTTCATCG
 
. : . : . : . : . : . :
JMFF025H02+ TATTTGAATAATTGGTTATTGGTCCAAGAAGCTGTCTTTTTCATGGATTGTGATGGATGA
JMFF017L22+ TATTTGAATAATTGGTTATTGGTCCAAGAAGCTGTCTTTTTCATGGATTGTGATGGATGA
JMFF046L14+ TATTTGAATAATTGGTTATTGGTCCAAGAAGCTGTCTTTTTCATGGATTGTGATGGATGA
                      ____________________________________________________________
consensus TATTTGAATAATTGGTTATTGGTCCAAGAAGCTGTCTTTTTCATGGATTGTGATGGATGA
 
. : . : . : . : . : . :
JMFF025H02+ GGAGCATGGCACCAAACATGTTAGCACTACTCACTCTGCCATGAAAAAGATGACAGACTT
JMFF017L22+ GGAGCATGGCACCAAACATGTTAGCACTACTCACTCTGCCATGAAAAAGATGACAGACTT
JMFF046L14+ GGAGCATGGCACCAAACATGTTAGCACTACTCACTCTGCCATGAAAAAGATGACAGACTT
                      ____________________________________________________________
consensus GGAGCATGGCACCAAACATGTTAGCACTACTCACTCTGCCATGAAAAAGATGACAGACTT
 
. : . : . : . : . : . :
JMFF025H02+ GTCCCCATGGTCTGCTCAAGACTTGGTTCATTTCTTTTGGGGATTTTCAATAGGTTTAAT
JMFF017L22+ GTCCCCATGGTCTGCTCAAGACTTGGTTCATTTCTTTTGGGGATTTTCAATAGGTTTAAT
JMFF046L14+ GTCCCCATGGTCTGCTCAAGACTTGGTTCATTTCTTTTGGGGATTTTCAATAGGTTTAAT
                      ____________________________________________________________
consensus GTCCCCATGGTCTGCTCAAGACTTGGTTCATTTCTTTTGGGGATTTTCAATAGGTTTAAT
 
. : . : . : . : . : . :
JMFF025H02+ TCTATGTTAAAAAGGTTGTGTACATTAATCTACTTTAGACACTAAAGATAAGTGCTTTTG
JMFF017L22+ TCTATGTTAAAAAGGTTGTGTACATTAATCTACTTTAGACACTAAAGATAAGTGCTTTTG
JMFF046L14+ TCTATGTTAAAAAGGTTGTGTACATTAATCTACTTTAGACACTAAAGATAAGTGCTTTTG
                      ____________________________________________________________
consensus TCTATGTTAAAAAGGTTGTGTACATTAATCTACTTTAGACACTAAAGATAAGTGCTTTTG
 
. : . : . : . : . : . :
JMFF025H02+ TTTTTTGCCCAACTTGCCCAACTTGATAACTTAGCTTTATAGTTACGGCAGAAACCTCTT
JMFF017L22+ TTTTTTGCCCAACTTGCCCAACTTGATAACTTAGCTTTATAGTTACGGCAGAAACCTCTT
JMFF046L14+ TTTTTTGCCCAACTTGCCCAACTTGATAACTTAGCTTTATAGTTACGGCAGAAACCTCTT
                      ____________________________________________________________
consensus TTTTTTGCCCAACTTGCCCAACTTGATAACTTAGCTTTATAGTTACGGCAGAAACCTCTT
 
. : . : . : . : . : . :
JMFF025H02+ TCACCGACCTCAGAGCAAGAGGCTTGAGTTTCCAGGACCAGAGGGGTGAAA
JMFF017L22+ TCACCGACCTCAGAGCAAGAGGCTTGAGTTTCCAGGACCAGAGGGGTGAAA
JMFF046L14+ TCACCGACCTCAGAGCAAGAGGCTTGAGTTTCCAGGACCAGAGGGGTGAAATTCTCGACG
                      ____________________________________________________________
consensus TCACCGACCTCAGAGCAAGAGGCTTGAGTTTCCAGGACCAGAGGGGTGAAATTCTCGACG