Previous Contig 001990:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046J08Sequence447001990 (2)pir|T05752|T057527e-29hypothetical protein M4I22.90 - Arabidopsis thaliana>gb:ATCHRIV66_1546609 Arabid
JMFN028K11Sequence547001990 (2)gb:AP003766_18332014e-29Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P000

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN028K11+ AGCCCAGCTCCATTGATGAATTGAAGAACTTACATAATTAACGTA
                      ____________________________________________________________
consensus AGCCCAGCTCCATTGATGAATTGAAGAACTTACATAATTAACGTA
 
. : . : . : . : . : . :
JMFN028K11+ ACAATTCAAGAAGCAACTAACATAAATAAGATAGATGTGCCAAAAAGGAAGAGAAATTAA
                      ____________________________________________________________
consensus ACAATTCAAGAAGCAACTAACATAAATAAGATAGATGTGCCAAAAAGGAAGAGAAATTAA
 
. : . : . : . : . : . :
JMFN028K11+ TGAAGAACCAACCATACATGCAATGGGGTAAATTAAATATCCTAATTAACGTAACCTAGC
                      ____________________________________________________________
consensus TGAAGAACCAACCATACATGCAATGGGGTAAATTAAATATCCTAATTAACGTAACCTAGC
 
. : . : . : . : . : . :
JMFN028K11+ CAGCCAGCCTAGAAATGATTGACAATGATATCCTCAACCAGCATCCTAGATTTGTCCATC
JMFF046J08+ GATTTGTTCATC
                      ____________________________________________________________
consensus CAGCCAGCCTAGAAATGATTGACAATGATATCCTCAACCAGCATCCTAGATTTGTTCATC
 
. : . : . : . : . : . :
JMFN028K11+ AAATCTGGACTGAGCCTGAACATGAGCACACAAAACTCCATCTCGCTCAGGCATCCATCT
JMFF046J08+ AAATCTGGACTCAACCTAAACATGAGAACACAAAACTCCATCTTATTCAAACACCCATCG
                      ____________________________________________________________
consensus AAATCTGGACTGAGCCTGAACATGAGCACACAAAACTCCATCTTGTTCAGGCATCCATCT
 
. : . : . : . : . : . :
JMFN028K11+ CCGTCCACGTCCCCTTCATTCAACATGCACCTCAGCTCCTCGTCGCTCAT
JMFF046J08+ CCGTCCATGTCCCCTTCCTTCAACATGCACCGCACCTCCTCGTCGCTCATCGGAAGTCCC
                      ____________________________________________________________
consensus CCGTCCATGTCCCCTTCCTTCAACATGCACCTCAGCTCCTCGTCGCTCATCGGAAGTCCC
 
. : . : . : . : . : . :
JMFF046J08+ AGAATCGCCGACGACTTCTTCTTCAAGCTCTCGAACGTGATAACGCCCTTCTCCTCCTCC
                      ____________________________________________________________
consensus AGAATCGCCGACGACTTCTTCTTCAAGCTCTCGAACGTGATAACGCCCTTCTCCTCCTCC
 
. : . : . : . : . : . :
JMFF046J08+ GCCAGCAGCCGGAACCCGTCGCAGAGCTCCTTCATGAACCCCTCCGTCCCCAGACTCTCC
                      ____________________________________________________________
consensus GCCAGCAGCCGGAACCCGTCGCAGAGCTCCTTCATGAACCCCTCCGTCCCCAGACTCTCC
 
. : . : . : . : . : . :
JMFF046J08+ ACCATCGCCGGAAACAGGTCCTCAAACACTACCACCTCGCCGCACCCCACTCCCGCCATC
                      ____________________________________________________________
consensus ACCATCGCCGGAAACAGGTCCTCAAACACTACCACCTCGCCGCACCCCACTCCCGCCATC
 
. : . : . : . : . : . :
JMFF046J08+ ATATCGCTTATGAAATATCTCAAGATCAGAACCTCGCAATTTACCCCTTCCAATGACTCT
                      ____________________________________________________________
consensus ATATCGCTTATGAAATATCTCAAGATCAGAACCTCGCAATTTACCCCTTCCAATGACTCT
 
. : . : . : . : . : . :
JMFF046J08+ GAGAAACTTAATGTATCCAACAAAAATATGTCAAGAATTGGAGAAGGAAATAAAGATCGG
                      ____________________________________________________________
consensus GAGAAACTTAATGTATCCAACAAAAATATGTCAAGAATTGGAGAAGGAAATAAAGATCGG