Previous Contig 001986:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046H02Sequence553001986 (3)gb:AY303171_15974204e-80Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.458010643 (3)gb:AY303171_15974205e-33Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.
JMFN025M19Sequence604001986 (3)gb:AY303171_1597420e-104Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.
JMFS092B04Sequence617001986 (3)gb:AY303171_1597420e-102Solanum bulbocastanum chromosome 8 clone 177O13, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN025M19+ AGCAGTTGGCCTGGTGTTTGACGT
                      ____________________________________________________________
consensus AGCAGTTGGCCTGGTGTTTGACGT
 
. : . : . : . : . : . :
JMFN025M19+ GAAGGAAATGCATGTGGATTTATAACTACGTCCGGAACTATCCCTTGTATTGTAAAAGGA
                      ____________________________________________________________
consensus GAAGGAAATGCATGTGGATTTATAACTACGTCCGGAACTATCCCTTGTATTGTAAAAGGA
 
. : . : . : . : . : . :
JMFN025M19+ AAGTTCTCCTGAGATTCTAGAAAACCGAGCACACCCTTTTGCCCATGCATACTAGAAAAT
                      ____________________________________________________________
consensus AAGTTCTCCTGAGATTCTAGAAAACCGAGCACACCCTTTTGCCCATGCATACTAGAAAAT
 
. : . : . : . : . : . :
JMFN025M19+ TTGTCTCCAAGACAAGGAGAACGAACCTGTCTCAGAGACACAACAGCAAAGCTTTTTCCC
                      ____________________________________________________________
consensus TTGTCTCCAAGACAAGGAGAACGAACCTGTCTCAGAGACACAACAGCAAAGCTTTTTCCC
 
. : . : . : . : . : . :
JMFN025M19+ TCATCATTACCAGAGAGTACAACCTTCTGAACCATGCCTCTTTCTGTATGCTTCAGTTTA
                      ____________________________________________________________
consensus TCATCATTACCAGAGAGTACAACCTTCTGAACCATGCCTCTTTCTGTATGCTTCAGTTTA
 
. : . : . : . : . : . :
JMFN025M19+ ACACTGTGATCAGCCCCTGATTCCGCATACTTTCCAATGACAATATCACCAGTTTGAAGG
JMFS092B04+ TGTGATCAGCCCCTGATTCCGCATACTTTCCAATGACAATATCACCAGTTTGAAGG
                      ____________________________________________________________
consensus ACACTGTGATCAGCCCCTGATTCCGCATACTTTCCAATGACAATATCACCAGTTTGAAGG
 
. : . : . : . : . : . :
JMFN025M19+ TTTGCACCAATGAATGGAAAGCCATCATCATCAAGGCTGTCAACGCGTCCTATCTTACTT
JMFS092B04+ TTTGCACCAATGAATGGAAAGCCATCATCATCAAGGCTGTCAACGCGTCCTATCTTACTT
                      ____________________________________________________________
consensus TTTGCACCAATGAATGGAAAGCCATCATCATCAAGGCTGTCAACGCGTCCTATCTTACTT
 
. : . : . : . : . : . :
JMFN025M19+ TGTGTTTTTCCAAAAATTACGGCATCCTCCAGTTTCATCTTCTTTCCCAGGGATTCCTTA
JMFS092B04+ TGTGTTTTTCCAAAAATTACGGCATCCTCCAGTTTCATCTTCTTTCCCAGGGATTCCTTA
                      ____________________________________________________________
consensus TGTGTTTTTCCAAAAATTACGGCATCCTCCAGTTTCATCTTCTTTCCCAGGGATTCCTTA
 
. : . : . : . : . : . :
JMFN025M19+ TTATCAACCTCAGCCTTGTAACTTCTAATATGCTCTGACCGAAACATACCACGCTCCAAA
JMFS092B04+ TTATCAACCTCAGCCTTGTAACTTCTAATATGCTCTGACCGAAACATACCACGCTCCAAA
                      ____________________________________________________________
consensus TTATCAACCTCAGCCTTGTAACTTCTAATATGCTCTGACCGAAACATACCACGCTCCAAA
 
. : . : . : . : . : . :
JMFN025M19+ GAAGCACGGTTCATTACTAAAGAATCCTCTTGGTTGTACCCTAGGTGAACGTTAACTGCC
JMFS092B04+ GAAGCACGGTTCATTACTAAAGAATCCTCTTGGTTGTACCCTAGGTGAACGTTAACTGCC
JMFF046H02+ AACGTTAACTGCC
                      ____________________________________________________________
consensus GAAGCACGGTTCATTACTAAAGAATCCTCTTGGTTGTACCCTAGGTGAACGTTAACTGCC
 
. : . : . : . : . : . :
JMFN025M19+ ACAATTGCACACTGGCCATTGTAGTATTCAGGGTGTGGCA
JMFS092B04+ ACAATTGCACACTGGCCATTGTAGTATTCAGGGTGTGGCAGCATCGATCTATGATAATTA
JMFF046H02+ ACAATTGCACACTGGCCATNGTAGTATTCAGGGTGTGGCAGCATCGATCTATGATAATTA
                      ____________________________________________________________
consensus ACAATTGCACACTGGCCATTGTAGTATTCAGGGTGTGGCAGCATCGATCTATGATAATTA
 
. : . : . : . : . : . :
JMFS092B04+ GGGTCTTTGGGCTTTCCAAGGCAATCTGACAGCATGGTACGAAAAAGAGGCCTCTGAGGA
JMFF046H02+ GGGTCTTTGGGCTTTCCAAGGCAATCTGACAGCATGGTACGAAAAAGAGGCCTCTGAGGA
                      ____________________________________________________________
consensus GGGTCTTTGGGCTTTCCAAGGCAATCTGACAGCATGGTACGAAAAAGAGGCCTCTGAGGA
 
. : . : . : . : . : . :
JMFS092B04+ TAATACAGTTGATGAGTATTAGTATCTATTCTAACATTCGGGTTCAAAGTAGGGAATCCA
JMFF046H02+ TAATACAGTTGATGAGTATTAGTATCTATTCTAACATTCGGGTTCAAAGTAGGGAATCCA
                      ____________________________________________________________
consensus TAATACAGTTGATGAGTATTAGTATCTATTCTAACATTCGGGTTCAAAGTAGGGAATCCA
 
. : . : . : . : . : . :
JMFS092B04+ ATGGCTTGTTGACTATGCTTCTCAGACTGGTAAAGGACCCTCCTCGCATGATCATGGTTG
JMFF046H02+ ATGGCTTGTTGACTATGCTTCTCAGACTGGTAAAGGACCCTCCTCGCATGATCATGGTTG
                      ____________________________________________________________
consensus ATGGCTTGTTGACTATGCTTCTCAGACTGGTAAAGGACCCTCCTCGCATGATCATGGTTG
 
. : . : . : . : . : . :
JMFS092B04+ GCAAAAGGGATAATCCCACAGCTCAAACCCAGTAGAAATGACAAGTCAAGTTCACAGTGT
JMFF046H02+ GCAAAAGGGATAATCCCACAGCTCAAACCCAGTAGAAATGACAAGTCAAGTTCACAGTGT
                      ____________________________________________________________
consensus GCAAAAGGGATAATCCCACAGCTCAAACCCAGTAGAAATGACAAGTCAAGTTCACAGTGT
 
. : . : . : . : . : . :
JMFS092B04+ GTATACTTTGCAGGTGGATCC
JMFF046H02+ GTATACTTTGCAGGTGGATCCTCCTTGCAGGCTTCAAGGAGGTAGTTCACTCCCCAAGCA
                      ____________________________________________________________
consensus GTATACTTTGCAGGTGGATCCTCCTTGCAGGCTTCAAGGAGGTAGTTCACTCCCCAAGCA
 
. : . : . : . : . : . :
JMFF046H02+ GTTCGACAATCTTCTTCTTCTTCAGAACCAATAAATTCAACTATTCCATTATCCAGAAAA
                      ____________________________________________________________
consensus GTTCGACAATCTTCTTCTTCTTCAGAACCAATAAATTCAACTATTCCATTATCCAGAAAA
 
. : . : . : . : . : . :
JMFF046H02+ GATTGAAAGGAGTCTCCATCTTTCAGAAATTGAATTTTCTTTAAATTTTCAACAACAAGA
                      ____________________________________________________________
consensus GATTGAAAGGAGTCTCCATCTTTCAGAAATTGAATTTTCTTTAAATTTTCAACAACAAGA
 
. : . : . : . : . : . :
JMFF046H02+ AGAGGGCGCAGGATTCGTCCAGCATCAGAAAAAATTCGGACTTCGTGGTGTTGTTCATCT
                      ____________________________________________________________
consensus AGAGGGCGCAGGATTCGTCCAGCATCAGAAAAAATTCGGACTTCGTGGTGTTGTTCATCT