Previous Contig 001985:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013C15Sequence554001985 (4)pir|G84455|G844555e-33hypothetical protein At2g04280 [imported] - Arabidopsis thaliana>gb:AC007213_153
JMFF039K06Sequence636001985 (4)pir|T06628|T066284e-41hypothetical protein T20K18.50 - Arabidopsis thaliana>gb:ATCHRIV34_1545034 Arabi
JMFF046G19Sequence647001985 (4)pir|T06628|T066282e-38hypothetical protein T20K18.50 - Arabidopsis thaliana>gb:ATCHRIV34_1545034 Arabi513021759gb:AF325013_17864673e-08Arabidopsis thaliana At1g17620 (At1g17620/F11A6_23) mRNA, complete cds.
JMSF023F13Sequence702001985 (4)pir|G84455|G844552e-51hypothetical protein At2g04280 [imported] - Arabidopsis thaliana>gb:AC007213_153772012299 (2)pir|T06628|T066289e-91hypothetical protein T20K18.50 - Arabidopsis thaliana>gb:ATCHRIV34_1545034 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023F13+ TAAACCGCCATGCCATGTG
                      ____________________________________________________________
consensus TAAACCGCCATGCCATGTG
 
. : . : . : . : . : . :
JMFF039K06+ CCCAAACTNGTAAAAATGTACATCCTT
JMSF023F13+ GCAGGAGGTCTCGTTCGAGCCAGGGACGGGCTTCCCAAACTTGTAAAAATGTACATCCTT
                      ____________________________________________________________
consensus GCAGGAGGTCTCGTTCGAGCCAGGGACGGGCTTCCCAAACTTGTAAAAATGTACATCCTT
 
. : . : . : . : . : . :
JMFF039K06+ GAACTTCTCAATAGTAGCTTTCATCAACAAATGGAACACATCCGGGTCCCTTACAGTCAA
JMFF013C15+ CTTACAGTCAA
JMSF023F13+ GAACTTCTCAATAGTAGCTTTCATCAACAAATGGAACACATCCGGGT-CCTTACAGTCAA
JMFF046G19+ AGTAGCTTTCATCAACAAATGGAACACATCCGGGT-CCTTACAGTCAA
                      ____________________________________________________________
consensus GAACTTCTCAATAGTAGCTTTCATCAACAAATGGAACACATCCGGGT-CCTTACAGTCAA
 
. : . : . : . : . : . :
JMFF039K06+ TAGGCTCATCCGTTTTTCCTTGGCATTCAAGTTCATTACCAGTTTCAGTTTCGGTGACTG
JMFF013C15+ TAGGCTCATCCGTTTTTCCTTGGCATTCAAGTTCATTACCAGTTTCAGTTTCGGTGACTG
JMSF023F13+ TAGGCTCATCCGTTTTTCCTTGGCATTCAAGTTCATTACCAGTTTCAGTTTCGGTGACTG
JMFF046G19+ TAGGCTCATCCGTTTTTCCTTGGCATTCAAGTTCATTACCAGTTTCAGTTTCGGTGACTG
                      ____________________________________________________________
consensus TAGGCTCATCCGTTTTTCCTTGGCATTCAAGTTCATTACCAGTTTCAGTTTCGGTGACTG
 
. : . : . : . : . : . :
JMFF039K06+ GCATCGCAATATCAACATCAGTAAGGTTAATAAAGGTGGCAAATGCAGTCTGATTTGCAC
JMFF013C15+ GCATCGCAATATCAACATCAGTAAGGTTAATAAAGGTGGCAAATGCAGTCTGATTTGCAC
JMSF023F13+ GCATCGCAATATCAACATCAGTAAGGTTAATAAAGGTGGCAAATGCAGTCTGATTTGCAC
JMFF046G19+ GCATCGCAATATCAACATCAGTAAGGTTAATAAAGGTGGCAAATGCAGTCTGATTTGCAC
                      ____________________________________________________________
consensus GCATCGCAATATCAACATCAGTAAGGTTAATAAAGGTGGCAAATGCAGTCTGATTTGCAC
 
. : . : . : . : . : . :
JMFF039K06+ CAATAAAGTCCTCCCCCGTCTTTACCACCGTGTCATCAGCTTTAAATGTGGCATTTGATT
JMFF013C15+ CAATAAAGTCCTCCCCCGTCTTTACCACCGTGTCATCAGCTTTAAATGTGGCATTTGATT
JMSF023F13+ CAATAAAGTCCTCCCCCGTCTTTACCACCGTGTCATCAGCTTTAAATGTGGCATTTGATT
JMFF046G19+ CAATAAAGTCCTCCCCCGTCTTTACCACCGTGTCATCAGCTTTAAATGTGGCATTTGATT
                      ____________________________________________________________
consensus CAATAAAGTCCTCCCCCGTCTTTACCACCGTGTCATCAGCTTTAAATGTGGCATTTGATT
 
. : . : . : . : . : . :
JMFF039K06+ TGGATGTAAGAAAATTAGTCATCTTAGCAGAAGGGTGAAACAATGGATCTTCAGGCTGAT
JMFF013C15+ TGGATGTAAGAAAATTAGTCATCTTAGCAGAAGGGTGAAACAATGGATCTTCAGGCTGAT
JMSF023F13+ TGGATGTAAGAAAATTAGTCATCTTAGCAGAAGGGTGAAACAATGGATCTTCAGGCTGAT
JMFF046G19+ TGGATGTAAGAAAATTAGTCATCTTAGCAGAAGGGTGAAACAATGGATCTTCAGGCTGAT
                      ____________________________________________________________
consensus TGGATGTAAGAAAATTAGTCATCTTAGCAGAAGGGTGAAACAATGGATCTTCAGGCTGAT
 
. : . : . : . : . : . :
JMFF039K06+ AAGTGGCCGCTATTATAGTGAAAATCAAGACCACAAGTACAAATACCGTGAAACCGAGGT
JMFF013C15+ AAGTGGCCGCTATTATAGTGAAAATCAAGACCACAAGTACAAATACCGTGAAACCGAGGT
JMSF023F13+ AAGTGGCCGCTATTATAGTGAAAATCAAGACCACAAGTACAAATACCGTGAAACCGAGGT
JMFF046G19+ AAGTGGCCGCTATTATAGTGAAAATCAAGACCACAAGTACAAATACCGTGAAACCGAGGT
                      ____________________________________________________________
consensus AAGTGGCCGCTATTATAGTGAAAATCAAGACCACAAGTACAAATACCGTGAAACCGAGGT
 
. : . : . : . : . : . :
JMFF039K06+ TCCTTATCATAGCCAGTGCATCTTGCCCTAAATTCTCCGGCCTAAAACCTGCATTCCTTG
JMFF013C15+ TCCTTATCATAGCCAGTGCATCTTGCCCTAAATTCTCCGGCCTAAAACCTGCATTCCTTG
JMSF023F13+ TCCTTATCATAGCCAGTGCATCTTGCCCTAAATTCTCCGGCCTAAAACCTGCATTCCTTG
JMFF046G19+ TCCTTATCATAGCCAGTGCATCTTGCCCTAAATTCTCCGGCCTAAAACCTGCATTCCTTG
                      ____________________________________________________________
consensus TCCTTATCATAGCCAGTGCATCTTGCCCTAAATTCTCCGGCCTAAAACCTGCATTCCTTG
 
. : . : . : . : . : . :
JMFF039K06+ ATCCCCAAACCGTTGACCGACCCATCATTCTTTCTACCCTCAGAAACCACAATCTCCAAA
JMFF013C15+ ATCCCCAAACCGTTGACCGACCCATCATTCTTTCTACCCTCAGAAACCACAATCTCCAAA
JMSF023F13+ ATCCCCAAACCGTTGACCGACCCATCATTCTTTCTACCCTCAGAAACCACAATCTCCAAA
JMFF046G19+ ATCCCCAAACCGTTGACCGACCCATCATTCTTTCTACCCTCAGAAACCACAATCTCCAAA
                      ____________________________________________________________
consensus ATCCCCAAACCGTTGACCGACCCATCATTCTTTCTACCCTCAGAAACCACAATCTCCAAA
 
. : . : . : . : . : . :
JMFF039K06+ GCAAATCGGGAAAATAACAGACTTAAAAGCTGATTTAATCTTACAATTAGGCTAGCATTT
JMFF013C15+ GCAAATCGGGAAAATAACAGACTTAAAAGCTGATTTAATCTTACAATTAGGCTAGCATTT
JMSF023F13+ GCAAATCGGGAAAATAACAGACTTAAAAGCTGATTTAATCTTACAATTAGGCTAGCATTT
JMFF046G19+ GCAAATCGGGAAAATAACAGACTTAAAAGCTGATTTAATCTTACAATTAGGCTAGCATTT
                      ____________________________________________________________
consensus GCAAATCGGGAAAATAACAGACTTAAAAGCTGATTTAATCTTACAATTAGGCTAGCATTT
 
. : . : . : . : . : . :
JMFF039K06+ AGAGATTGCGGATGATCTATCGAAGCATTGCCCACACTTTCTCTCTGTGTGGAGTGGAGT
JMFF013C15+ AGAGATTGCGGATGATCTATCGAAGCATTGCCCACACTTTCTCTCTGTGTGGAGTGGAGT
JMSF023F13+ AGAGATTGCGGATGATCTATCGAAGCATTGCCCACACTTTCTCTCTGTGTGGAGTGGAGT
JMFF046G19+ AGAGATTGCGGATGATCTATCGAAGCATTGCCCACACTTTCTCTCTGTGTGGAGTGGAGT
                      ____________________________________________________________
consensus AGAGATTGCGGATGATCTATCGAAGCATTGCCCACACTTTCTCTCTGTGTGGAGTGGAGT
 
. : . : . : . : . : . :
JMFF039K06+ GGA
JMFF013C15+ GGA
JMSF023F13+ GGAGTGGAGCTCCTTACTTCCTT
JMFF046G19+ GGAGTGGAGCTCCTTACTTCCTTAGGGGGAGGGGGGTTAAGTCAGCGGTGATTTGATTAT
                      ____________________________________________________________
consensus GGAGTGGAGCTCCTTACTTCCTTAGGGGGAGGGGGGTTAAGTCAGCGGTGATTTGATTAT