Previous Contig 001981:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF038A19Sequence456001981 (2)gb:STAAP1_17226883e-60Solanum tuberosum mRNA for amino acid transporter (aap1 gene).692010629 (3)pir|T50691|T506914e-72amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab
JMFF046E17Sequence633001981 (2)gb:STAAP1_17226882e-64Solanum tuberosum mRNA for amino acid transporter (aap1 gene).551010629 (3)pir|T50691|T506911e-36amino acid permease 6 [imported] - Arabidopsis thaliana>gb:AB025627_1516495 Arab

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046E17+ AAGGAGAATCATGGCCCTCTTTGTGATAACAGT
                      ____________________________________________________________
consensus AAGGAGAATCATGGCCCTCTTTGTGATAACAGT
 
. : . : . : . : . : . :
JMFF038A19+ ACAGTGACTCC
JMFF046E17+ GGACTTCTTCACAGCTACCATACTAATGGAAGCGGTGATGGTGTAACCGACAGTGACTCC
                      ____________________________________________________________
consensus GGACTTCTTCACAGCTACCATACTAATGGAAGCGGTGATGGTGTAACCGACAGTGACTCC
 
. : . : . : . : . : . :
JMFF038A19+ GACAAGATTAGCGTACTGAGCAATCCCGCACAGCTGAACCTTCACGCCACCCAAATGAGA
JMFF046E17+ GACAAGATTAGCGTACTGAGCAATCCCGCACAGCTGAACCTTCACGCCACCCAAATGAGA
                      ____________________________________________________________
consensus GACAAGATTAGCGTACTGAGCAATCCCGCACAGCTGAACCTTCACGCCACCCAAATGAGA
 
. : . : . : . : . : . :
JMFF038A19+ ACGGACGACGTCCATGTAGGTGTAGTTTCTCTTGCCGTCGACGGGGCCGGGAGAGCGGTA
JMFF046E17+ ACGGACGACGTCCATGTAGGTGTAGTTTCTCTTGCCGTCGACGGGGCCGGGAGAGCGGTA
                      ____________________________________________________________
consensus ACGGACGACGTCCATGTAGGTGTAGTTTCTCTTGCCGTCGACGGGGCCGGGAGAGCGGTA
 
. : . : . : . : . : . :
JMFF038A19+ ACAGTCGACGAGAAGGGTGGAGGTGAAGTAAGTGATGAAGGAGAACGTCATGAGGACGAC
JMFF046E17+ ACAGTCGACGAGAAGGGTGGAGGTGAAGTAAGTGATGAAGGAGAGCGTCATGAGGACGAC
                      ____________________________________________________________
consensus ACAGTCGACGAGAAGGGTGGAGGTGAAGTAAGTGATGAAGGAGAGCGTCATGAGGACGAC
 
. : . : . : . : . : . :
JMFF038A19+ CGGACCGGCGAGCCAGCCGAGCTGAGCGATGGCCCAAGCTAAAGACAGCACTCCCGACCC
JMFF046E17+ CGGACCGGCGACCCAGCCGAGCTGAGCGATGGCCCAAGCTAAAGACAGCACTCCCGACCC
                      ____________________________________________________________
consensus CGGACCGGCGAGCCAGCCGAGCTGAGCGATGGCCCAAGCTAAAGACAGCACTCCCGACCC
 
. : . : . : . : . : . :
JMFF038A19+ AATCACGGCGGTGATGATGTGCGCGCTCGCCGTCAGCAGAGTCCC
JMFF046E17+ AATCACGGCGGTGATGATGTGCGCGCTCGCCGTCAGCAGAGTCCCTTCAGTTCAAAAACA
                      ____________________________________________________________
consensus AATCACGGCGGTGATGATGTGCGCGCTCGCCGTCAGCAGAGTCCCTTCAGTTCAAAAACA
 
. : . : . : . : . : . :
JMFF046E17+ GACCGCCGGCCGGCCAACAAGTTAACAACATAGAACATGGGAACACAATAAATTTATGTA
                      ____________________________________________________________
consensus GACCGCCGGCCGGCCAACAAGTTAACAACATAGAACATGGGAACACAATAAATTTATGTA
 
. : . : . : . : . : . :
JMFF046E17+ TTATGTGTACGTTACGTACCAGTTCTCTTCTCTCTGCCATCGTCGTCGAAATTCTTCTGA
                      ____________________________________________________________
consensus TTATGTGTACGTTACGTACCAGTTCTCTTCTCTCTGCCATCGTCGTCGAAATTCTTCTGA
 
. : . : . : . : . : . :
JMFF046E17+ ATCTCCCCATTTTCCAGGGATTGATCCACATACATGGGGTCTTTTCCGACAGCCATTTGA
                      ____________________________________________________________
consensus ATCTCCCCATTTTCCAGGGATTGATCCACATACATGGGGTCTTTTCCGACAGCCATTTGA
 
. : . : . : . : . : . :
JMFF046E17+ GTTACCTCTACTCTTGAGTGTGTATTGTACTTCTCTCTCTATCTGTAGGAGACGGATTAC
                      ____________________________________________________________
consensus GTTACCTCTACTCTTGAGTGTGTATTGTACTTCTCTCTCTATCTGTAGGAGACGGATTAC