Previous Contig 001978:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF030I16Sequence604001978 (13)gb:BT004174_16372721e-44Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR715001978 (13)gb:BT004174_16372728e-41Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFF046E02Sequence604001978 (13)pir|F96593|F965936e-45hypothetical protein F7A10.20 [imported] - Arabidopsis thaliana>gb:AE005173_8934469001978 (13)pir|F96593|F965934e-09hypothetical protein F7A10.20 [imported] - Arabidopsis thaliana>gb:AE005173_8934
JMFN009N24Sequence593001978 (13)gb:BT004174_16372723e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFN016N14Sequence595001978 (13)gb:BT004174_16372724e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFN033D03Sequence612001978 (13)gb:BT004174_16372723e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFN039I17Sequence610001978 (13)gb:BT004174_16372727e-46Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFN041H06Sequence638001978 (13)gb:BT004174_16372723e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFN045D13Sequence636001978 (13)gb:BT004174_16372723e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFN045P01Sequence618001978 (13)gb:BT004174_16372723e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMFS076H04Sequence657001978 (13)gb:BT004174_16372723e-45Arabidopsis thaliana clone RAFL15-47-C07 (R20936) unknown protein (At3g13720) mR
JMSF028N11Sequence559001978 (13)pir|F96593|F965934e-30hypothetical protein F7A10.20 [imported] - Arabidopsis thaliana>gb:AE005173_8934227001436 (120)pir|T02873|T028731e-26probable photosystem II oxygen-evolving complex protein 2 precursor - rice>gb:AF

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF046E02- CC
                      ____________________________________________________________
consensus CC
 
. : . : . : . : . : . :
rJMFF046E02- TTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTGGATTAACTTTGGAGTTTATTT
rJMFF030I16- TGGATTAACTTTGGAGTTTATTT
                      ____________________________________________________________
consensus TTATGGCGGATCACCCTGGAGAGTTTTTTTTTTTTTTTGGATTAACTTTGGAGTTTATTT
 
. : . : . : . : . : . :
rJMFF046E02- CTTACAAAATTAAAGCATAAGAAATTTACAACAAAAAGCACAAGAAATATGAGAAAATTA
rJMFF030I16- CTTACAAAATTAAAGCATAAGAAATTTACAACAAAAAGCACAAGAAATATGAGAAAATTA
                      ____________________________________________________________
consensus CTTACAAAATTAAAGCATAAGAAATTTACAACAAAAAGCACAAGAAATATGAGAAAATTA
 
. : . : . : . : . : . :
rJMFF046E02- ACAACAAACAAATGAACAATCGTTAACAATTCAAAGCAAATAATGGTGGAACGAAAAAAT
rJMFF030I16- ACAACAAACAAATGAACAATCGTTAACAATTCAAAGCAAATAATGGTGGAACGAAAAAAT
JMFN045D13+ AT
JMFS076H04+ GAACGAAAAAAT
                      ____________________________________________________________
consensus ACAACAAACAAATGAACAATCGTTAACAATTCAAAGCAAATAATGGTGGAACGAAAAAAT
 
. : . : . : . : . : . :
rJMFF046E02- TAAAAGTGAAAACTAAAACATACTTGGAATACAGAATACAGCACACTAAGACGACGGAGC
rJMFF030I16- TAAAAGTGAAAACTAAAACATACTTGGAATACAGAATACAGCACACTAAGACGACGGAGC
JMFN045D13+ TAAAAGTGAAAACTAAAACATAC-TGGAATACAGAATACAGCACACTAAGACGACGGAGC
JMFS076H04+ TAAAAGTGANAACTAAAACATACTTGGAATACAGAATACAGCACACTAAGACGACGGAGC
JMFN045P01+ GGAATACAGAATACAGCACACTAAGACGACGGAGC
JMFN039I17+ GGAATACAGAATACAGCACACTAAGACGACGGAGC
JMFN041H06+ AAAACTAAAACATACTTGGAATACAGAATACAGCACACTAAGACGACGGAGC
JMFN016N14+ GACGACGGAGC
JMFN009N24+ AAGACGACGGAGC
JMFN033D03+ ATACAGCACACTAAGACGACGGAGC
JMFF030I16+ CGGAGC
JMFF046E02+ GGAGC
                      ____________________________________________________________
consensus TAAAAGTGAAAACTAAAACATACTTGGAATACAGAATACAGCACACTAAGACGACGGAGC
 
. : . : . : . : . : . :
rJMFF046E02- AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
rJMFF030I16- AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN045D13+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFS076H04+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN045P01+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN039I17+ AGATGGAGCGTGGCCGGCTAAGAAAGTGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN041H06+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN016N14+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN009N24+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFN033D03+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMFF030I16+ AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
JMSF028N11+ GGCGAACAAATCATCGGT
JMFF046E02+ AGATGGAGCGTGG-CGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
                      ____________________________________________________________
consensus AGATGGAGCGTGGCCGGCTAAGAAAGCGCCGGATTCCTCATCGGCGAACAAATCATCGGT
 
. : . : . : . : . : . :
rJMFF046E02- CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCCACCAGCAGCGAAATGAGGAT
rJMFF030I16- CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN045D13+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFS076H04+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN045P01+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN039I17+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN041H06+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN016N14+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN009N24+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFN033D03+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMFF030I16+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
JMSF028N11+ CTTCNTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCANCGAAATGAGGAT
JMFF046E02+ CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
                      ____________________________________________________________
consensus CTTCCTGAAAGCACCGTGGACCAAAACAACCACGGCTCCGACCAGCAGCGAAATGAGGAT
 
. : . : . : . : . : . :
rJMFF046E02- ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
rJMFF030I16- ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN045D13+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFS076H04+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN045P01+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN039I17+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN041H06+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN016N14+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN009N24+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFN033D03+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMFF030I16+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
JMSF028N11+ ATTGNCGGTGGCGTTTGTGAAGAGGAGCANAACGATTGTAGNGACGGAGAGAACAATCAG
JMFF046E02+ ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
                      ____________________________________________________________
consensus ATTGGCGGTGGCGTTTGTGAAGAGGAGCAGAACGATTGTAGCGACGGAGAGAACAATCAG
 
. : . : . : . : . : . :
rJMFF046E02- CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGT
rJMFF030I16- CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN045D13+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFS076H04+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN045P01+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN039I17+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN041H06+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN016N14+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN009N24+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFN033D03+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFF030I16+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMSF028N11+ CACCACNCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
JMFF046E02+ CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
                      ____________________________________________________________
consensus CACCACGCGGTCGTTAATCAAGCGGCCAACGATGATCAGCGGCTCGTCGCGGAGGAAGTA
 
. : . : . : . : . : . :
rJMFF030I16- GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN045D13+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFS076H04+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN045P01+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN039I17+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN041H06+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN016N14+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN009N24+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFN033D03+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMFF030I16+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
JMSF028N11+ GAGGAAGAGCCACGCCGCCATGAGGGNGACGAAGACGATGAGCGAGATCGGNTGCCAGAG
JMFF046E02+ GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
                      ____________________________________________________________
consensus GAGGAAGAGCCACGCCGCCATGAGGGCGACGAAGACGATGAGCGAGATCGGGTGCCAGAG
 
. : . : . : . : . : . :
rJMFF030I16- GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN045D13+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFS076H04+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN045P01+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN039I17+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN041H06+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN016N14+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN009N24+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFN033D03+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMFF030I16+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
JMSF028N11+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGNGTAGTTCATCCGGAAGTAGGCGAG
JMFF046E02+ GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
                      ____________________________________________________________
consensus GAGGCTGAGGAAGAGAATAACGAGGACTACGAGGGCGTAGTTCATCCGGAAGTAGGCGAG
 
. : . : . : . : . : . :
rJMFF030I16- GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN045D13+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFS076H04+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN045P01+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN039I17+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN041H06+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN016N14+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN009N24+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFN033D03+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFF030I16+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMSF028N11+ NTTCGTTNTGATCCGCGAAACGGCNTCNTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
JMFF046E02+ GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
                      ____________________________________________________________
consensus GTTCGTTTTGATCCGCGAAACGGCGTCGTGGAAGTTCGAGGGCAGGCCGATAGAGTGGAA
 
. : . : . : . : . : . :
rJMFF030I16- GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN045D13+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFS076H04+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN045P01+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN039I17+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN041H06+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN016N14+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN009N24+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFN033D03+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMFF030I16+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
JMSF028N11+ GTTGAACATCTCTCGCCACGGCCGCCNCATNCCTAGNCCCTCCNTTATCCGCTCCTTCNT
JMFF046E02+ GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
                      ____________________________________________________________
consensus GTTGAACATCTCTCGCCACGGCCGCCGCATGCCTAGCCCCTCCTTTATCCGCTCCTTCGT
 
. : . : . : . : . : . :
rJMFF030I16- GCGGGAGATGTACTCCAAGCTCGCGCCGGCAG
JMFN045D13+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFS076H04+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFN045P01+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFN039I17+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFN041H06+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFN016N14+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFN009N24+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFN033D03+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMFF030I16+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
JMSF028N11+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTNTGCCGTATGT
JMFF046E02+ GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
                      ____________________________________________________________
consensus GCGGGAGATGTACTCCAAGCTCGCGCCGGCAGAGGAAGACGTCGGAATTGTGCCGTATGT
 
. : . : . : . : . : . :
JMFN045D13+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAG
JMFS076H04+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGAC
JMFN045P01+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAG
JMFN039I17+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAG
JMFN041H06+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGACG
JMFN016N14+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGA
JMFN009N24+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGA
JMFN033D03+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGACGG
JMFF030I16+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGACGGTGTGATGCGAT
JMSF028N11+ CGTCATATTTTCCGGNGAATTTCGGACTGCTCAAGGAGGAGAGACGGTGTGATGCGAT
JMFF046E02+ CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGACGGTGTGATGCGATGC
                      ____________________________________________________________
consensus CGTCATATTTTCCGGCGAATTTCGGACTGCTCAAGGAGGAGAGACGGTGTGATGCGATGC