Previous Contig 001975:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046D17Sequence537001975 (2)493010624 (4)gb:AB079670_15239179e-07Arabidopsis thaliana AtPPC6;6 mRNA for protein phosphatase 2C, partial cds.
JMFF050L18Sequence636001975 (2)597010624 (4)gb:AY062496_15651524e-24Arabidopsis thaliana putative protein phosphatase-2C (PP2C) (At3g02750; F13E7.31

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF050L18+ GCAAAATCCAATGATCCAATCCACTTCAACTTCAAA
                      ____________________________________________________________
consensus GCAAAATCCAATGATCCAATCCACTTCAACTTCAAA
 
. : . : . : . : . : . :
JMFF050L18+ AGCAATCTAATCCAATCCACTTCAACTTCAAAAGCACTCTAATCCAATCCACTTCAACTT
                      ____________________________________________________________
consensus AGCAATCTAATCCAATCCACTTCAACTTCAAAAGCACTCTAATCCAATCCACTTCAACTT
 
. : . : . : . : . : . :
JMFF050L18+ CACAAGCAATCAAATCCAATCCACTTCAACTTCAAAAGCACTCTAATCCAATCCACTTTT
JMFF046D17+ ATCAAATCCAATCCACTTCACTTTCAAAAGCACTCTAATCCAATCCACTTTT
                      ____________________________________________________________
consensus CACAAGCAATCAAATCCAATCCACTTCACTTTCAAAAGCACTCTAATCCAATCCACTTTT
 
. : . : . : . : . : . :
JMFF050L18+ CAACTTCAAAAGCACTCTAATCCAAATATCCAATCCCCTCAAATCATTTCAGCTTCAAAA
JMFF046D17+ CAACTTCAAAAGCACTCTAATCCAAATATCCAATCCCCTCAAATCATTTCAGCTTCAAAA
                      ____________________________________________________________
consensus CAACTTCAAAAGCACTCTAATCCAAATATCCAATCCCCTCAAATCATTTCAGCTTCAAAA
 
. : . : . : . : . : . :
JMFF050L18+ AGCAATGAACTTTCGAAGAAAACAAACAGGAAACATCAACTCAATCCTATATTTAATAAC
JMFF046D17+ AGCAATGAACTTTCGAAGAAAACAAACAGGAAACATCAACTCAATCCTATATTTAATAAC
                      ____________________________________________________________
consensus AGCAATGAACTTTCGAAGAAAACAAACAGGAAACATCAACTCAATCCTATATTTAATAAC
 
. : . : . : . : . : . :
JMFF050L18+ TAAAACAACTATATGACAATGATATAAACATAATACTTATAACCAACAAGAACAAAGTCA
JMFF046D17+ TAAAACAACTATATGACAATGATATAAACATAATACTTATAACCAACAAGAACAAAGTCA
                      ____________________________________________________________
consensus TAAAACAACTATATGACAATGATATAAACATAATACTTATAACCAACAAGAACAAAGTCA
 
. : . : . : . : . : . :
JMFF050L18+ CCCACTAGCTTTTTGTCCTTATTCTGCTCTTTTCCCGAAATGATTATACGACCGGAGAAA
JMFF046D17+ CCCACTAGCTTTTTGTCCTTATTCTGCTCTTTTCCCGAAATGATTATACGACCGGAGAAA
                      ____________________________________________________________
consensus CCCACTAGCTTTTTGTCCTTATTCTGCTCTTTTCCCGAAATGATTATACGACCGGAGAAA
 
. : . : . : . : . : . :
JMFF050L18+ GCTAAAAGTGGGAGAAAGCCTACAGAACAGATCTATAAAGCAGTGCTTTCTGAAAATTTC
JMFF046D17+ GCTAAAAGTGGGAGAAAGCCTACAGAACAGATCTATAAAGCAGTGCTTTCTGAAAATTTC
                      ____________________________________________________________
consensus GCTAAAAGTGGGAGAAAGCCTACAGAACAGATCTATAAAGCAGTGCTTTCTGAAAATTTC
 
. : . : . : . : . : . :
JMFF050L18+ TTTAATAGTATCAATCAAATCAGTACCTTTCTCTCTCCCTCCCTCAAACTAGGAATTCAA
JMFF046D17+ TTTAATAGTATCAATCAAATCAGTACCTTTCTCTCTCCCTCCCTCAAACTAGGAATTCAA
                      ____________________________________________________________
consensus TTTAATAGTATCAATCAAATCAGTACCTTTCTCTCTCCCTCCCTCAAACTAGGAATTCAA
 
. : . : . : . : . : . :
JMFF050L18+ GACATGAAACATCGAAACCTTGAGACCGCCACCATCGATGAAATACCCCTTCTCCGGTCG
JMFF046D17+ GACATGAAACATCGAAACCTTGAGACCGCCACCATCGATGAAATACCCCTTCTCCGGTCG
                      ____________________________________________________________
consensus GACATGAAACATCGAAACCTTGAGACCGCCACCATCGATGAAATACCCCTTCTCCGGTCG
 
. : . : . : . : . : . :
JMFF050L18+ AATCCAATCAATGCTAAACAAATAAGTAATGCCCAGAGTTGACAAATAATGGGGGAAACC
JMFF046D17+ AATCCAATCAATGCTAAACAAATAAGTAATGCCCAGAGTTGACAAATAATGGGGGAAACC
                      ____________________________________________________________
consensus AATCCAATCAATGCTAAACAAATAAGTAATGCCCAGAGTTGACAAATAATGGGGGAAACC