Previous Contig 001971:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF046C06Sequence603001971 (2)gb:AB026647_15172037e-34Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.530010615 (3)gb:AY062730_15653860.010Arabidopsis thaliana Unknown protein (At2g19870; F6F22.10) mRNA, complete cds.>g
JMSF013B14Sequence489001971 (2)gb:AB026647_15172031e-20Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MJL12.728010615 (3)gb:AY062730_15653861e-06Arabidopsis thaliana Unknown protein (At2g19870; F6F22.10) mRNA, complete cds.>g

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046C06+ ATC
                      ____________________________________________________________
consensus ATC
 
. : . : . : . : . : . :
JMFF046C06+ AAATGCCGATTTAAACAACGATCTACGGCCGCAGCAGAATTAATCATGGGAGTGTACCAG
                      ____________________________________________________________
consensus AAATGCCGATTTAAACAACGATCTACGGCCGCAGCAGAATTAATCATGGGAGTGTACCAG
 
. : . : . : . : . : . :
JMSF013B14+ TTCTGCAACGCG
JMFF046C06+ GGGGAGGCTCGGAGGGCAAGCGCCTGCGAGGACCTCCTCCACCAGGGTTTCTGCAACGCG
                      ____________________________________________________________
consensus GGGGAGGCTCGGAGGGCAAGCGCCTGCGAGGACCTCCTCCACCAGGGTTTCTGCAACGCG
 
. : . : . : . : . : . :
JMSF013B14+ GTATCGCTTACCGGAGATGNCAATTCGGATAATGCGGAGGTAAGTGACATGGTTGTGCTT
JMFF046C06+ GTATCGCTTACCGGAGATGGCAATTCGGATAATGCGGAGGTAAGTGACATGGTTGTGCTT
                      ____________________________________________________________
consensus GTATCGCTTACCGGAGATGGCAATTCGGATAATGCGGAGGTAAGTGACATGGTTGTGCTT
 
. : . : . : . : . : . :
JMSF013B14+ GTAGCCTCGCTGCTGGCCTGTCCAACGGAAAATGTCCAGTGCCAGGTCCGGGTCGCATTG
JMFF046C06+ GTAGCCTCGCTGCTGGCCTGTCCAACGGAAAATGTCCAGTGCCAGGTCCGGGTCGCATTG
                      ____________________________________________________________
consensus GTAGCCTCGCTGCTGGCCTGTCCAACGGAAAATGTCCAGTGCCAGGTCCGGGTCGCATTG
 
. : . : . : . : . : . :
JMSF013B14+ GGACTGCAAGGCTTCGTCGACGTCTGACGGCGTGAACCCCGGACGGAGTTTGCTTATCCA
JMFF046C06+ GGACTGCAAGGCTTCGTCGACGTCTGACGGCGTGAACCCCGGACGGAGTTTGCTTATCCA
                      ____________________________________________________________
consensus GGACTGCAAGGCTTCGTCGACGTCTGACGGCGTGAACCCCGGACGGAGTTTGCTTATCCA
 
. : . : . : . : . : . :
JMSF013B14+ TGAATCGAAATGCTTTTCCGATGGGGTTAGAGTCCGGGGATTAGGGTTTGGGAGGTCTTT
JMFF046C06+ TGAATCGAAATGCTTTTCCGATGGGGTTAGAGTCCGGGGATTAGGGTTTGGGAGGTCTTT
                      ____________________________________________________________
consensus TGAATCGAAATGCTTTTCCGATGGGGTTAGAGTCCGGGGATTAGGGTTTGGGAGGTCTTT
 
. : . : . : . : . : . :
JMSF013B14+ AGATGGGTGCGAGAGGGTTGGTGCAGTAGGGTGGAGGTGAGAAGATGAAGCTGCGGAAAG
JMFF046C06+ AGATGGGTGCGAGAGGGTTGGTGCAGTAGGGTGGAGGTGAGAAGATGAAGCTGCGGAAAG
                      ____________________________________________________________
consensus AGATGGGTGCGAGAGGGTTGGTGCAGTAGGGTGGAGGTGAGAAGATGAAGCTGCGGAAAG
 
. : . : . : . : . : . :
JMSF013B14+ GGGCCGGAGAGAAAGAGAAGAGAGGATAGATGATCGGAATCTGGAGATAAAGGGATGTGG
JMFF046C06+ GGGCCGGAGAGAAAGAGAAGAGAGGATAGATGATCGGAATCTGGAGATAAAGGGATGTGG
                      ____________________________________________________________
consensus GGGCCGGAGAGAAAGAGAAGAGAGGATAGATGATCGGAATCTGGAGATAAAGGGATGTGG
 
. : . : . : . : . : . :
JMSF013B14+ TAACACTGCTCGCATTGCTCCTGGAACGCAGGCCAAGAATTCGCCGGAATTGGGTTTCGG
JMFF046C06+ TAACACTGCTCGCATTGCTCCTGGAACGCAGGCCAAGAATTCGCCGGAATTGGGTTTCGG
                      ____________________________________________________________
consensus TAACACTGCTCGCATTGCTCCTGGAACGCAGGCCAAGAATTCGCCGGAATTGGGTTTCGG
 
. : . : . : . : . : . :
JMSF013B14+ GATTTTCAGGGTAGAAATGGAGCGCGTAGTTAGGTCACCGCTTTGAACTTCTACT
JMFF046C06+ GATTTTCAGGGTAGAAATGGAGCGCGTAGTTAGGTCACCGCTTTGAACTTCTACTAAAAC
                      ____________________________________________________________
consensus GATTTTCAGGGTAGAAATGGAGCGCGTAGTTAGGTCACCGCTTTGAACTTCTACTAAAAC