Previous Contig 001965:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009M18Sequence517001965 (9)pir|T51575|T515756e-282-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554754010603 (9)gb:AY233204_15916826e-81Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF024K11Sequence436001965 (9)pir|T51575|T515752e-392-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554752010603 (9)gb:AY233204_15916823e-69Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF025B12Sequence511001965 (9)pir|T51575|T515755e-532-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554767010603 (9)gb:AY233204_15916829e-75Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF034E03Sequence543001965 (9)pir|T51575|T515755e-632-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554684010603 (9)gb:AY233204_15916825e-72Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF039F21Sequence560001965 (9)pir|T51575|T515757e-372-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554802010603 (9)gb:AY233204_15916823e-83Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFF046A08Sequence570001965 (9)gb:ATH278629_15522654e-26Arabidopsis thaliana mRNA for Oxalyl-CoA decarboxylase (ocd gene).596010603 (9)gb:AY233204_15916821e-32Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMFN012D19Sequence611001965 (9)pir|T51575|T515756e-692-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554
JMSF014C07Sequence487001965 (9)pir|T51575|T515751e-492-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554787010603 (9)gb:AY233204_15916828e-87Vitis vinifera putative oxalyl-CoA decarboxylase (Oxc) mRNA, partial cds.
JMSF038N09Sequence607001965 (9)pir|T51575|T515755e-662-hydroxyphytanoyl-CoA lyase-like protein - Arabidopsis thaliana>gb:ATT10B6_1554922010603 (9)gb:ATH278629_15522655e-98Arabidopsis thaliana mRNA for Oxalyl-CoA decarboxylase (ocd gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012D19+ ATCCTGCGCTTCGGCGATCAATC
                      ____________________________________________________________
consensus ATCCTGCGCTTCGGCGATCAATC
 
. : . : . : . : . : . :
JMFN012D19+ TCTCCGCCTCCGATTCACTCACGGTCTGGTGGAGCACATCGGAGGGGAGATCCAAGTAAC
JMFF034E03+ GTGGAGCACATCGGAGGGGAGATCCAAGTAAC
JMSF038N09+ TCCGATTCACTCACGGTCTGGTGGAGCACATCGGAGGGGAGATCCAAGTAAC
                      ____________________________________________________________
consensus TCTCCGCCTCCGATTCACTCACGGTCTGGTGGAGCACATCGGAGGGGAGATCCAAGTAAC
 
. : . : . : . : . : . :
JMFN012D19+ ACCCGCCGGGGCGGCCGGCGGCAGCCCAATCCAGAACCTCGAAAACGCAAGCGGGGACTT
JMFF034E03+ ACCCGCCGGGGCGGCCGGCGGCGGCCCAATCCAGAACCTCGAAAACGCAAGCGGGGACTT
JMFF025B12+ AAACGCAAGCGGGGACTT
JMSF038N09+ ACCCGCCGGGGCGGCCGGCGGCGGCCCAATCCAGAACCTCGAAAACGCAAGCGGGGACTT
                      ____________________________________________________________
consensus ACCCGCCGGGGCGGCCGGCGGCGGCCCAATCCAGAACCTCGAAAACGCAAGCGGGGACTT
 
. : . : . : . : . : . :
JMFN012D19+ TGGAGATATCGGTGGCTTTAGCGGAGAACTTGGAGAAGGGTTTCACCGCTTCAATTTGGT
JMFF034E03+ TGGAGATATCGGTGGCTTTAGCGGAGAACTTGGAGAAGGGTTTCACCGCTCCAATTTGGT
JMFF025B12+ TGGAGATATCGGTGGCTTTAGCGGAGAACTTGGAGAAGGGTTTCACCGCTTCAATTTGGT
JMFF024K11+ GT
JMSF038N09+ TGGAGATATCGGTGGCTTTAGCGGAGAACTTGGAGAAGGGTTTCACCGCTTCAATTTGGT
JMSF014C07+ GTGGCTTTAGCGGAGAACTTGGAGAAGGGTTTCACCGCTTCAATTTGGT
                      ____________________________________________________________
consensus TGGAGATATCGGTGGCTTTAGCGGAGAACTTGGAGAAGGGTTTCACCGCTTCAATTTGGT
 
. : . : . : . : . : . :
JMFN012D19+ CCAGCTCTTGGAAGTCCCCGCG-CCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
JMFF034E03+ CCAGCTCTTGGAAGTCCCCGCG-CCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
JMFF025B12+ CCAGCTCTTGGAAGTCCCCGCG-CCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
JMFF024K11+ CCAGCTCTTGGAAGTCCCCGCGCCCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
JMSF038N09+ CCAGCTCTTGGAAGTCCCCGCG-CCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
JMSF014C07+ CCAGCTCTTGGAAGTCCCCGCG-CCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
JMFF039F21+ TCTGATCGCAGGAGCCGGAAATCATG
                      ____________________________________________________________
consensus CCAGCTCTTGGAAGTCCCCGCG-CCCAAAATCTTTCTGATCGCAGGAGCCGGAAATCATG
 
. : . : . : . : . : . :
JMFN012D19+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMFF034E03+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMFF025B12+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMFF024K11+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMSF038N09+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMSF014C07+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMFF039F21+ ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMFF009M18+ CACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
JMFF046A08+ GAGAGGCCGGCGAGACCATGCACGCATCCG
                      ____________________________________________________________
consensus ACCAACGGCCACGTATTCACGGCGGCGTTAGAGAGGCCGGCGAGACCATGCACGCATCCG
 
. : . : . : . : . : . :
JMFN012D19+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMFF034E03+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMFF025B12+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMFF024K11+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMSF038N09+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMSF014C07+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMFF039F21+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMFF009M18+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
JMFF046A08+ GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
                      ____________________________________________________________
consensus GGTCCCGATACAGTGAGTAGAATCCCCGGTCGGCCGGTGAGGTAACCATAGGCGGAAGCA
 
. : . : . : . : . : . :
JMFN012D19+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMFF034E03+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMFF025B12+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMFF024K11+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMSF038N09+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMSF014C07+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMFF039F21+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMFF009M18+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
JMFF046A08+ GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
                      ____________________________________________________________
consensus GCATAGCCGGCGGATTGCTCGTTGTGGAAGGCGATGAAGCGGATGCCAAGCGCCACCGCG
 
. : . : . : . : . : . :
JMFN012D19+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
JMFF034E03+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
JMFF025B12+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
JMFF024K11+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
JMSF038N09+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
JMSF014C07+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
JMFF039F21+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACCCCGGCT
JMFF009M18+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACCCCGGCT
JMFF046A08+ CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
                      ____________________________________________________________
consensus CGGTTGGCTAAGGAAGTAACCGGTATGCCGACCACCCCGAACATCCGGTCCACTCCGGCT
 
. : . : . : . : . : . :
JMFN012D19+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMFF034E03+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMFF025B12+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMFF024K11+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMSF038N09+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMSF014C07+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMFF039F21+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMFF009M18+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
JMFF046A08+ CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
                      ____________________________________________________________
consensus CGTGCCAGAGACATGGCCACAAGCATGTTGGTGTCGACGTCCGCCATTAAATTATCTCGG
 
. : . : . : . : . : . :
JMFN012D19+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCT
JMFF034E03+ AAATGCACCACTACACTAGATTCACTGCCACT
JMFF025B12+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
JMFF024K11+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
JMSF038N09+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
JMSF014C07+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
JMFF039F21+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
JMFF009M18+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
JMFF046A08+ AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
                      ____________________________________________________________
consensus AAATGCACCACTACACTAGATTCACTGCCACTGGGATTGCTTCAATTCTTCGATATAATA
 
. : . : . : . : . : . :
JMFF025B12+ ATATACTATCGGAT
JMFF024K11+ ATATACTATCGGAT
JMSF038N09+ ATATACTATCGGATT
JMSF014C07+ ATATACTATCGGATTGGT
JMFF039F21+ ATATACTATCGGATTGGTGATGTATAGCTTTAGCTTTAGCCTTTTATATATGCAAATTAG
JMFF009M18+ ATATACTATCGGATTGGTGATGTATAGCTTTAGCTTTAGCCTTTTATATATGCAAATTAG
JMFF046A08+ ATATACTATCGGATTGGTGATGTATAGCTTTAGCTTTAGCCTTTTATATATGCAAATTAG
                      ____________________________________________________________
consensus ATATACTATCGGATTGGTGATGTATAGCTTTAGCTTTAGCCTTTTATATATGCAAATTAG
 
. : . : . : . : . : . :
JMFF039F21+ GACTTAGGAGCAAAAGTGCCTTCACCAAATATTCATCGTCTGGGCAACGGCAGCGTTTGG
JMFF009M18+ GACTTAGGAGCAAAAGTGCCTTCACCAAATATTCATCGTCTGGGCAACGGCAGCGTTTGG
JMFF046A08+ GACTTAGGAGCAAAAGTGCCTTCACCAAATATTCATCGTCTGGGCAACGGCAGCGTTTGG
                      ____________________________________________________________
consensus GACTTAGGAGCAAAAGTGCCTTCACCAAATATTCATCGTCTGGGCAACGGCAGCGTTTGG
 
. : . : . : . : . : . :
JMFF039F21+ ATGGGAAGAAAGAAGCAAAATTTGATTGGCTCCACCGCCACACGCCACTC
JMFF009M18+ ATGGGAAGAAAGAAGCAAAATTTGATTGGCTCCACCGCCACACGCCACTC
JMFF046A08+ ATGGGAAGAAAGAAGCAAAATTTGATTGGCTCCACCGCCACACGCCACTCTATCAATGCT
                      ____________________________________________________________
consensus ATGGGAAGAAAGAAGCAAAATTTGATTGGCTCCACCGCCACACGCCACTCTATCAATGCT
 
. : . : . : . : . : . :
JMFF046A08+ AAGCAAACTTTGCTTTGAACTCTTTTTTGAGCTTTTCTCACCTTGCAGCCTTGCTCTAAC
                      ____________________________________________________________
consensus AAGCAAACTTTGCTTTGAACTCTTTTTTGAGCTTTTCTCACCTTGCAGCCTTGCTCTAAC