Previous Contig 001953:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045M12Sequence641001953 (4)pir|T51471|T514712e-40farnesylated protein ATFP6-like protein - Arabidopsis thaliana>gb:ATK3M16_155351640001953 (4)pir|T51471|T514712e-40farnesylated protein ATFP6-like protein - Arabidopsis thaliana>gb:ATK3M16_155351
JMFN019I20Sequence611001953 (4)pir|T51471|T514712e-40farnesylated protein ATFP6-like protein - Arabidopsis thaliana>gb:ATK3M16_155351
JMFN028G14Sequence646001953 (4)pir|T51471|T514712e-40farnesylated protein ATFP6-like protein - Arabidopsis thaliana>gb:ATK3M16_155351

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF045M12- CCTTATGGCGGATCACCCTGACGAGXXXXXXXXXXXXXXXXXXXXXAAGAAAAGAAGA
JMFN028G14+ AAGAAAAGAAGA
                      ____________________________________________________________
consensus CCTTATGGCGGATCACCCTGACGAGNNNNNNNNNNNNNNNNNNNNNAAGAAAAGAAGA
 
. : . : . : . : . : . :
rJMFF045M12- ATTCCGGGCTCTTTGTGCTAACAAAAGAAAGTTAAGGGGGCAGAAGTATAGTTAACTAAA
JMFN028G14+ ATTCCGGGCTCTNTGTGCTAACAAAAGAAAGTTAAGGGGNCAGAAGTATAATTAACTAAA
JMFN019I20+ GTTAAGGGGGCAGAAGTATAATTAACTAAA
JMFF045M12+ AACAAAAGAAAGTTAAGGGGGCAGAAGTATAATTAACTAAA
                      ____________________________________________________________
consensus ATTCCGGGCTCTTTGTGCTAACAAAAGAAAGTTAAGGGGGCAGAAGTATAATTAACTAAA
 
. : . : . : . : . : . :
rJMFF045M12- AATGAAGGGTCGTCGTCGTCGTCGTCACATAATGGAACAAGCATTAGGGTTATCTTCACT
JMFN028G14+ AATGAAGGGTCGTCGTCGTCGTCGTCACATAATGGAACAAGCATTAGGGTTATCTTCACT
JMFN019I20+ AATGAAGGGTCGTCGTCGTCGTCGTCACATAATGGAACAAGCATTAGGGTTATCTTCACT
JMFF045M12+ AATGAAGGGTCGTCGTCGTCGTCGTCACATAATGGAACAAGCATTAGGGTTATCTTCACT
                      ____________________________________________________________
consensus AATGAAGGGTCGTCGTCGTCGTCGTCACATAATGGAACAAGCATTAGGGTTATCTTCACT
 
. : . : . : . : . : . :
rJMFF045M12- GAACATGAAAGACAGCTTTTCTTCAGTAGCATTAGGGGGAGCAATCGCCTGCGGGACGTT
JMFN028G14+ GAACATGAAAGACAGCTTTTCTTCAGTAGCATTAGGGGGAGCAATCGCCTGCGGGACGTT
JMFN019I20+ GAACATGAAAGACAGCTTTTCTTCAGTAGCATTAGGGGGAGCAATCGCCTGCGGGACGTT
JMFF045M12+ GAACATGAAAGACAGCTTTTCTTCAGTAGCATTAGGGGGAGCAATCGCCTGCGGGACGTT
                      ____________________________________________________________
consensus GAACATGAAAGACAGCTTTTCTTCAGTAGCATTAGGGGGAGCAATCGCCTGCGGGACGTT
 
. : . : . : . : . : . :
rJMFF045M12- CTTCACGTAGCCCGCTGGGGCCCTCTTGTCGTACGCCTGCGTGGCGTAAGGGTAGTACAC
JMFN028G14+ CTTCACGTAGCCCGCTGGGGCCCTCTTGTCGTACGCCTGCGTGGCGTAAGGGTAGTACAC
JMFN019I20+ CTTCACGTAGCCCGCTGGGGCCCTCTTGTCGTACGCCTGCGTGGCGTAAGGGTAGTACAC
JMFF045M12+ CTTCACGTAGCCCGCTGGGGCCCTCTTGTCGTACGCCTGCGTGGCGTAAGGGTAGTACAC
                      ____________________________________________________________
consensus CTTCACGTAGCCCGCTGGGGCCCTCTTGTCGTACGCCTGCGTGGCGTAAGGGTAGTACAC
 
. : . : . : . : . : . :
rJMFF045M12- TACGTTGTATGGGATGTACGGCCAGAACTCTGCTCTTTTCCCTGTCTCTTTTACCCTCCT
JMFN028G14+ TACGTTGTATGGGATGTACGGCCAGAACTCTGCTCTTTTCCCTGTCTCTTTTACCCTCCT
JMFN019I20+ TACGTTGTATGGGATGTACGGCCAGAACTCTGCTCTTTTCCCTGTCTCTTTTACCCTCCT
JMFF045M12+ TACGTTGTATGGGATGTACGGCCAGAACTCTGCTCTTTTCCCTGTCTCTTTTACCCTCCT
                      ____________________________________________________________
consensus TACGTTGTATGGGATGTACGGCCAGAACTCTGCTCTTTTCCCTGTCTCTTTTACCCTCCT
 
. : . : . : . : . : . :
rJMFF045M12- CAACACCTTGTTTGGCTCCACGAAACCACGCACCGTCACCTTGCTTTGTTTCCGGTTCAC
JMFN028G14+ CAACACCTTGTTTGGCTCCACGAATCCACGCACCGTCACCTTGCTTTGTTTCCGGTTCAC
JMFN019I20+ CAACACCTTGTTTGGCTCCACGAATCCACGCACCGTCACCTTGCTTTGTTTCCGGTTCAC
JMFF045M12+ CAACACCTTGTTTGGCTCCACGAATCCACGCACCGTCACCTTGCTTTGTTTCCGGTTCAC
                      ____________________________________________________________
consensus CAACACCTTGTTTGGCTCCACGAATCCACGCACCGTCACCTTGCTTTGTTTCCGGTTCAC
 
. : . : . : . : . : . :
rJMFF045M12- TTCTATGCTTTTCACGCCTTTGATGTGTTTAATGGCGTTTCTGACTTTTCTTTCGCATCC
JMFN028G14+ TTCTATGCTTTTCACGCCTTTGATGTGTTTAATGGCGTTTCTGACTTTTCTTTCGCATCC
JMFN019I20+ TTCTATGCTTTTCACGCCTTTGATGTGTTTAATGGCGTTTCTGACTTTTCTTTCGCATCC
JMFF045M12+ TTCTATGCTTTTCACGCCTTTGATGTGTTTAATGGCGTTTCTGACTTTTCTTTCGCATCC
                      ____________________________________________________________
consensus TTCTATGCTTTTCACGCCTTTGATGTGTTTAATGGCGTTTCTGACTTTTCTTTCGCATCC
 
. : . : . : . : . : . :
rJMFF045M12- ATCGCAATCCATTTTGACTTTTATCTCCACCGTCTGCATTGATTTGGTTTTGCTTCCTGT
JMFN028G14+ ATCGCAATCCATTTTGACTTTTATCTCCACCGTCTGCATTGATTTGGTTTTGCTTCCTGT
JMFN019I20+ ATCGCAATCCATTTTGACTTTTATCTCCACCGTCTGCATTGATTTGGTTTTGCTTCCTGT
JMFF045M12+ ATCGCAATCCATTTTGACTTTTATCTCCACCGTCTGCATTGATTTGGTTTTGCTTCCTGT
                      ____________________________________________________________
consensus ATCGCAATCCATTTTGACTTTTATCTCCACCGTCTGCATTGATTTGGTTTTGCTTCCTGT
 
. : . : . : . : . : . :
rJMFF045M12- AGTGGTAAATGCGCAGAGTTTTGAAAGATACTCAAGGCCACCCATTTTCTTGAAATGAAT
JMFN028G14+ AGTGGTAAATGCGCAGAGTTTTGAAAGATACTCAAGGCCACCCATTTTCTTGAATTGAAT
JMFN019I20+ AGTGGTAAATGCGCAGAGTTTTGAAAGATACTCAAGGCCACCCATTTTCTTGAATTGAAT
JMFF045M12+ AGTGGTAAATGCGCAGAGTTTTGAAAGATACTCAAGGCCACCCATTTTCTTGAATTGAAT
                      ____________________________________________________________
consensus AGTGGTAAATGCGCAGAGTTTTGAAAGATACTCAAGGCCACCCATTTTCTTGAATTGAAT
 
. : . : . : . : . : . :
rJMFF045M12- TCAATTCCCTGTATGTCCTTTAATTCTATTCGGGAAAAGCTA
JMFN028G14+ TCAATTCCCTGTATGTCCTTTAATTCTATTCGGGAAAAGCTAAGTT-AAGAAGAAGAAGA
JMFN019I20+ TCAATTCCCTGTATGTCCTTTAATTCTATTCGGGAAAAGCTAAGTTAAAGAAGAAGAAGA
JMFF045M12+ TCAATTCCCTGTATGTCCTTTAATTCTATTCGGGAAAAGCTAAGTTAAAGAAGAAGAAGA
                      ____________________________________________________________
consensus TCAATTCCCTGTATGTCCTTTAATTCTATTCGGGAAAAGCTAAGTTAAAGAAGAAGAAGA
 
. : . : . : . : . : . :
JMFN028G14+ AAAAGAAGAGAAGCTTAA
JMFN019I20+ AAAAGAAGAGAAGCTTAAATTAAAGCTAGGCAGAGAGTTGT
JMFF045M12+ AAAAGAAGAGAAGCTTAAATTAAAGCTAGGCAGAGAGTTGTGTATAGTAATATGCATGAC
                      ____________________________________________________________
consensus AAAAGAAGAGAAGCTTAAATTAAAGCTAGGCAGAGAGTTGTGTATAGTAATATGCATGAC