Previous Contig 001951:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF034L21Sequence239001951 (5)492009831 (5)
JMFF036G11Sequence426001951 (5)pir|H86384|H863840.02440.1K hypothetical protein F2J7.8 - Arabidopsis thaliana>gb:AE005172_891468 Arab698009831 (5)gb:AC123513_11924100.001Dictyostelium discoideum strain AX4 chromosome 2 map 2779865-2840915, *** SEQUEN
JMFF045M07Sequence576001951 (5)gb:AY135361_13029700.026Plasmodium coatneyi merozoite surface protein-9 (msp9) gene, complete cds.403009831 (5)
JMFS127G12Sequence624001951 (5)
JMSF020D20Sequence641001951 (5)gb:AC115612_12059390.026Dictyostelium discoideum chromosome 2 map 6245135-6357017 strain AX4, complete s728009831 (5)gb:AC117075_12077640.025Dictyostelium discoideum chromosome 2 map 5201047-5455781 strain AX4, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS127G12+ TCCGGATTCTCNTC
                      ____________________________________________________________
consensus TCCGGATTCTCNTC
 
. : . : . : . : . : . :
JMFS127G12+ ATGGGCTTTCCGGGCTCAGCTCTGGGTTTCATTGCTCGGCCGCCGGTTGGATGATTCGAT
JMSF020D20+ TCTGGGTTTCATTGCTCGGCCGCCGGTTGGATGATTCGAT
                      ____________________________________________________________
consensus ATGGGCTTTCCGGGCTCAGCTCTGGGTTTCATTGCTCGGCCGCCGGTTGGATGATTCGAT
 
. : . : . : . : . : . :
JMFS127G12+ AACAACATCTTATATAACTCAGATCACAACGAAACCCCCCAAACAAAATTTCCCCGGAAA
JMSF020D20+ AACAACATCTTATATAACTCAGATCACAACGAAACCCCCCAAACAAAATTTCCCCGGAAA
                      ____________________________________________________________
consensus AACAACATCTTATATAACTCAGATCACAACGAAACCCCCCAAACAAAATTTCCCCGGAAA
 
. : . : . : . : . : . :
JMFS127G12+ GCTCTGGTCCAAGAACAAATTTAAAAAGCCAAAAATATGATCGGAAAACAAGTCAAAAGT
JMSF020D20+ GCTCTGGTCCAAGAACAAATTTAAAAAGCCAAAAATATGATCGGAAAACAAGTCAAAAGT
JMFF045M07+ AAAGCCAAAAATATGATCGGAAAACAAGTCAAAAGT
                      ____________________________________________________________
consensus GCTCTGGTCCAAGAACAAATTTAAAAAGCCAAAAATATGATCGGAAAACAAGTCAAAAGT
 
. : . : . : . : . : . :
JMFS127G12+ AAAAAAAATCAGCCGGAAAACCTCTCGGAAAATCAAGAAATTGTTACGGTTGTATCGGGA
JMSF020D20+ AAAAAAAATCAGCCGGAAAACCTCTCGGAAAATCAAGAAATTGTTACGGTTGTATCGGGA
JMFF036G11+ CCTCTCGGAAAATCAAGAAATTGTTACGGTTGTATCGGGA
JMFF045M07+ AAAAAAAATCAGCCGGAAAACCTCTCGGAAAATCAAGAAATTGTTACGGTTGTATCGGGA
                      ____________________________________________________________
consensus AAAAAAAATCAGCCGGAAAACCTCTCGGAAAATCAAGAAATTGTTACGGTTGTATCGGGA
 
. : . : . : . : . : . :
JMFS127G12+ AAGTATGTAAGAATCGCTTTATGTGAAATCCCCCAAAACACTCTACTCCAGAACAAGTCC
JMSF020D20+ AAGTATGTAAGAATCGCTTTATGTGAAATCCCCCAAAACACTCTACTCCAGAACAAGTCC
JMFF036G11+ AAGTATGTAAGAATCGCTTTATGTGAAATCCCCCAAAACACTCTACTCCAGAACAAGTCC
JMFF045M07+ AAGTATGTAAGAATCGCTTTATGTGAAATCCCCCAAAACACTCTACTCCAGAACAAGTCC
                      ____________________________________________________________
consensus AAGTATGTAAGAATCGCTTTATGTGAAATCCCCCAAAACACTCTACTCCAGAACAAGTCC
 
. : . : . : . : . : . :
JMFS127G12+ TTTTGGGCCTCAAACGCATCGAAACGGACGGGAAAACAACGGCGGCTCTCTGCTGAACTG
JMSF020D20+ TTTTGGGCCTCAAACGCATCGAAACGGACGGGAAAACAACGGCGGCTCTCTGCTGAACTG
JMFF036G11+ TTTTGGGCCTCAAACGCATCGAAACGGACGGGAAAACAACGGCGGCTCTCTGCTGAACTG
JMFF034L21+ CTG
JMFF045M07+ TTTTGGGCCTCAAACGCATCGAAACGGACGGGAAAACAACGGCGGCTCTCTGCTGAACTG
                      ____________________________________________________________
consensus TTTTGGGCCTCAAACGCATCGAAACGGACGGGAAAACAACGGCGGCTCTCTGCTGAACTG
 
. : . : . : . : . : . :
JMFS127G12+ AACAGCAGAGGAAAAATCTTTGCATACAGAGATTGAGCAAAACAGAAGAAACAACAACCC
JMSF020D20+ AACAGCAGAGGAAAAATCTTTGCATACAGAGATTGAGCAAAACAGAAGAAACAACAACCC
JMFF036G11+ AACAGCAGAGGAAAAATCTTTGCATACAGAGATTGAGCAAAACAGAAGAAACAACAACCC
JMFF034L21+ AACAGCAGAGGAAAAATCTTTGCATACAGAGATTGAGCAAAACAGAAGAAACAACAACCC
JMFF045M07+ AACAGCAGAGGAAAAATCTTTGCATACAGAGATTGAGCAAAACAGAAGAAACAACAACCC
                      ____________________________________________________________
consensus AACAGCAGAGGAAAAATCTTTGCATACAGAGATTGAGCAAAACAGAAGAAACAACAACCC
 
. : . : . : . : . : . :
JMFS127G12+ AGAGCTTCAACAAAAAAGCCCCAAACACAGAACCCAATCCAGACCTTGCCGACATAAAAT
JMSF020D20+ AGAGCTTCAACAAAAAAGCCCCAAACACAGAACCCAATCCAGACCTTGCCGACATAAAAT
JMFF036G11+ AGAGCTTCAACAAAAAAGCCCCAAACACAGAACCCAATCCAGACCTTGCCGACATAAAAT
JMFF034L21+ AGAGCTTCAACAAAAAAGCCCCAAACACAGAACCCAATCCAGACCTTGCCGACATAAAAT
JMFF045M07+ AGAGCTTCAACAAAAAAGCCCCAAACACAGAACCCAATCCAGACCTTGCCGACATAAAAT
                      ____________________________________________________________
consensus AGAGCTTCAACAAAAAAGCCCCAAACACAGAACCCAATCCAGACCTTGCCGACATAAAAT
 
. : . : . : . : . : . :
JMFS127G12+ CTCTTCAAACCACAAATCCTTCCACTCCTCACTCTCTCAAAGAGCCC
JMSF020D20+ CTCTTCAAACCACAAATCCTTCCACTCCTCACTCTCTCAAAGAGCCC
JMFF036G11+ CTCTTCAAACCACAAATCCTTCCACTCCTCACTCTCTCAAAGAGCCC
JMFF034L21+ CTCTTCAAACCACAAATCCTTCCACTCCTCACTCTCTCAAAGAGCCC
JMFF045M07+ CTCTTCAAACCACAAATCCTTCCACTCCTCACTCTCTCAAAGAGCCCTTCTCGAATCCGG
                      ____________________________________________________________
consensus CTCTTCAAACCACAAATCCTTCCACTCCTCACTCTCTCAAAGAGCCCTTCTCGAATCCGG
 
. : . : . : . : . : . :
JMFF045M07+ AAAAGTAAACAAAAGAGAAAAAATCGGATCAGATACTCTGATTTATAGATACAAAAAAAA
                      ____________________________________________________________
consensus AAAAGTAAACAAAAGAGAAAAAATCGGATCAGATACTCTGATTTATAGATACAAAAAAAA
 
. : . : . : . : . : . :
JMFF045M07+ AAAAAAACAATCTATCAAGAACCCAGCGAACCCAGCGAAAACCCAGAAGAGAAGAATCAC
                      ____________________________________________________________
consensus AAAAAAACAATCTATCAAGAACCCAGCGAACCCAGCGAAAACCCAGAAGAGAAGAATCAC
 
. : . : . : . : . : . :
JMFF045M07+ AGGATTAGAAACCTATGGCCCAGATTTCCCCTCTAAAACAAGACAAAATCCCCAGAAAAC
                      ____________________________________________________________
consensus AGGATTAGAAACCTATGGCCCAGATTTCCCCTCTAAAACAAGACAAAATCCCCAGAAAAC