Previous Contig 001946:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045L19Sequence647001946 (2)gb:AY102117_15777242e-37Arabidopsis thaliana AT5g47500/MNJ7_9 mRNA, complete cds.>gb:BT000565_1634843 Ar595021741gb:AY102117_15777242e-61Arabidopsis thaliana AT5g47500/MNJ7_9 mRNA, complete cds.>gb:BT000565_1634843 Ar
JMSF018K19Sequence264001946 (2)gb:AY102117_15777249e-13Arabidopsis thaliana AT5g47500/MNJ7_9 mRNA, complete cds.>gb:BT000565_1634843 Ar629010080 (11)sp|P49972|SR52_LYCES1e-67Signal recognition particle 54 kDa protein 2 (SRP54).>pir|S51598|S51598 signal r

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045L19+ CATTCCCGGCAGCGGCGCCGGCGCCGTATTCTTGAAGCTAATGTTTC
                      ____________________________________________________________
consensus CATTCCCGGCAGCGGCGCCGGCGCCGTATTCTTGAAGCTAATGTTTC
 
. : . : . : . : . : . :
JMFF045L19+ TGGCGGAGAAAAAGCTAGCAAACACCGTGACGGAAGCCGTNTGGTAAGTGCGGAGCTGCT
                      ____________________________________________________________
consensus TGGCGGAGAAAAAGCTAGCAAACACCGTGACGGAAGCCGTNTGGTAAGTGCGGAGCTGCT
 
. : . : . : . : . : . :
JMFF045L19+ GCCCATCTGGGCCGCGATCGCTTGCTCGGTCGTGCCATTCTATCCCGTCGTCTCCCTCCC
                      ____________________________________________________________
consensus GCCCATCTGGGCCGCGATCGCTTGCTCGGTCGTGCCATTCTATCCCGTCGTCTCCCTCCC
 
. : . : . : . : . : . :
JMSF018K19+ CCGGCACCACCACTTTCTCCACGTAGCA
JMFF045L19+ CGCGCCTTGAAACCTTATGTACGGTTTCGACGCCGGCACCACCACTTTCTCCACGTAGCA
                      ____________________________________________________________
consensus CGCGCCTTGAAACCTTATGTACGGTTTCGACGCCGGCACCACCACTTTCTCCACGTAGCA
 
. : . : . : . : . : . :
JMSF018K19+ ACCGGGACCGATTTGAATGAGGACGTTCATGCTATTGTGCTCCGGCACGGAATCAACGGC
JMFF045L19+ ACCGGGACCGATTTGAATGAGGACGTTCATGCTATTGTGCTCCGGCACGGAATCAACGGC
                      ____________________________________________________________
consensus ACCGGGACCGATTTGAATGAGGACGTTCATGCTATTGTGCTCCGGCACGGAATCAACGGC
 
. : . : . : . : . : . :
JMSF018K19+ GGCCTGAACAGAACGGAAGTCGCCGAAGCCGTCGAGGTCCACAAAGATGGTGCGGTTCCC
JMFF045L19+ GGCCTGAACAGAACGGAAGTCGCCGAAGCCGTCGAGGTCCACAAAGATGGTGCGGTTCCC
                      ____________________________________________________________
consensus GGCCTGAACAGAACGGAAGTCGCCGAAGCCGTCGAGGTCCACAAAGATGGTGCGGTTCCC
 
. : . : . : . : . : . :
JMSF018K19+ GGAGGGCCCCACCCAATGGTGCCCGTGCGTCCCGCTGCTAGAATTATTACTGGAACCGCC
JMFF045L19+ GGAGGGCCCCACCCAATGGTGCCCGTGCGTCCCGCTGCTAGAATTATTACTGGAACCGCC
                      ____________________________________________________________
consensus GGAGGGCCCCACCCAATGGTGCCCGTGCGTCCCGCTGCTAGAATTATTACTGGAACCGCC
 
. : . : . : . : . : . :
JMSF018K19+ GCAGCCGGCTGACGAGGGCGGCGGCGCCGATGGCGTTGCATGGAATAACGAGAAGA
JMFF045L19+ GCAGCCGGCTGACGAGGGCGGCGGCGCCGATGGCGTTGCATGGAATAACGAGAAGAATTG
                      ____________________________________________________________
consensus GCAGCCGGCTGACGAGGGCGGCGGCGCCGATGGCGTTGCATGGAATAACGAGAAGAATTG
 
. : . : . : . : . : . :
JMFF045L19+ CAGGAATAAGAAGAATAAGAAGAGAGGAGTGAGGGAATTCGCAGCCATGCAAGCAATGCA
                      ____________________________________________________________
consensus CAGGAATAAGAAGAATAAGAAGAGAGGAGTGAGGGAATTCGCAGCCATGCAAGCAATGCA
 
. : . : . : . : . : . :
JMFF045L19+ AATTGTAATGTAGAGAGAGAAAGAGAGAGAGAGAGTGAGGGGGAGGGTTTAATATAAATT
                      ____________________________________________________________
consensus AATTGTAATGTAGAGAGAGAAAGAGAGAGAGAGAGTGAGGGGGAGGGTTTAATATAAATT
 
. : . : . : . : . : . :
JMFF045L19+ TGCAGAAATGGAGTGAGGAATTTGCAGAATTTATAGTTGGGACGATACGTCGCAAATAAC
                      ____________________________________________________________
consensus TGCAGAAATGGAGTGAGGAATTTGCAGAATTTATAGTTGGGACGATACGTCGCAAATAAC