Previous Contig 001944:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009F07Sequence517001944 (20)pir|T00514|T005143e-29cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara506003672 (19)pir|G96611|G966113e-15probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF009M10Sequence613001944 (20)pir|T00514|T005146e-45cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara723003672 (19)pir|T00514|T005141e-46cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF013J10Sequence517001944 (20)pir|T00514|T005142e-30cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara753003672 (19)pir|T00514|T005143e-46cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF014O07Sequence554001944 (20)pir|T00514|T005148e-35cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara697003672 (19)pir|T09364|T093643e-39cytochrome P450 homolog F23K16.110 - Arabidopsis thaliana>gb:ATCHRIV91_1547932 A
JMFF020D23Sequence529001944 (20)pir|T00514|T005142e-31cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara726003672 (19)pir|T00514|T005143e-56cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF024P11Sequence432001944 (20)pir|T00514|T005149e-26cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara781003672 (19)pir|T00514|T005143e-39cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF025G02Sequence492001944 (20)pir|T00514|T005142e-30cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara700003672 (19)pir|T00514|T005143e-46cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF026A08Sequence554001944 (20)pir|T00514|T005148e-35cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara753003672 (19)pir|T00514|T005144e-46cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF026N05Sequence536001944 (20)pir|T00514|T005144e-32cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara600003672 (19)pir|G96611|G966114e-29probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF027A17Sequence508001944 (20)pir|T00514|T005141e-35cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara728003672 (19)pir|G96611|G966117e-45probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF034A01Sequence554001944 (20)pir|T00514|T005148e-35cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara772003672 (19)pir|T00514|T005142e-58cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF034N08Sequence526001944 (20)pir|T00514|T005142e-30cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara723003672 (19)pir|T09365|T093654e-44cytochrome P450 homolog F23K16.120 - Arabidopsis thaliana>gb:ATCHRIV91_1547933 A
JMFF038F10Sequence526001944 (20)pir|T00514|T005142e-30cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara727003672 (19)pir|T00514|T005143e-55cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFF040A05Sequence631001944 (20)pir|T00514|T005141e-42cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara687003672 (19)pir|G96611|G966112e-44probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF041H07Sequence655001944 (20)pir|T00514|T005145e-44cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara596003672 (19)pir|G96611|G966119e-33probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF045K09Sequence639001944 (20)pir|T00514|T005147e-42cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara582003672 (19)pir|G96611|G966111e-25probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFF046G20Sequence538001944 (20)pir|T00514|T005143e-36cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara555003672 (19)pir|G96611|G966113e-24probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMFN012J20Sequence629001944 (20)pir|T00514|T005142e-40cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFS043C10Sequence564001944 (20)pir|T00514|T005142e-40cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara
JMFS045D05Sequence639001944 (20)pir|T00514|T005141e-42cytochrome P450 homolog T20D16.19 - Arabidopsis thaliana>gb:AC002391_1530640 Ara

Alignment

This contig is upended


. : . : . : . : . : . :
JMFN012J20+ CGCATGATTGAAGGCCTTCTCGCAGGGAACATAAGGCAATCCAAGGCAG
JMFF009M10+ CTCGCAGGGAACATAAGGCAAGCCAAGGCAG
JMFF041H07+ CTCGCAGGGAACATAAGGCAATCCAAGGCAG
                      ____________________________________________________________
consensus CGCATGATTGAAGGCCTTCTCGCAGGGAACATAAGGCAATCCAAGGCAG
 
. : . : . : . : . : . :
JMFN012J20+ AGACTTTGAGGGTCATGGTGTAAGACGAGCTTAGAGATGGTGTCAAAGGTGAAGCGCTGG
JMFF009M10+ AGACTTTCAGGGTCATGGTGTAAGACGAGCTTCGAAATGGCGTCAAAGGTGAAGCGCTGG
JMFF041H07+ AGACTTTGAGGGTCATGGTGTAAGACGAGCTTAGAGATGGTGTCAAAGGTGAAGCGCTGG
JMFS045D05+ AGACTTTGAGGGTCATGGTGTAAGACGAGCTTAGAGATGGTGTCAAAGGTGAAGCGCTGG
JMFS043C10+ GGTGAAGCGCTGG
JMFF040A05+ GTGTAAGACGAGCTTAGAGATGGTGTCAAAGGTGAAGCGCTGG
JMFF045K09+ AAGACGAGCTTAGAGATGGTGTCAAAGGTGAAGCGCTGG
                      ____________________________________________________________
consensus AGACTTTGAGGGTCATGGTGTAAGACGAGCTTAGAGATGGTGTCAAAGGTGAAGCGCTGG
 
. : . : . : . : . : . :
JMFN012J20+ AAAACTTCTTGCAAATCAAACTCCGCT-CCTCTTCTGCGAACCAATCAAGAACTGGAAAC
JMFF009M10+ AAAACATCTTGCAAATCAAACTCCGCTCCCTCTTCTGCAAACCAATCAAGAACCGGCAAC
JMFF046G20+ GCAAACCAATCAAGAACCGGCAAC
JMFF041H07+ AAAACTTCTTGCAAATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
JMFS045D05+ AAAACTTCTTGCAAATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
JMFS043C10+ AAAACTTCTTGCAAATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
JMFF027A17+ ATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
JMFF040A05+ AAAACTTCTTGCAAATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
JMFF034A01+ AACCAATCAAGAACTGGAAAC
JMFF014O07+ AACCAATCAAGAACTGGAAAC
JMFF026A08+ AACCAATCAAGAACTGGAAAC
JMFF045K09+ AAAACTTCTGGCAAATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
                      ____________________________________________________________
consensus AAAACTTCTTGCAAATCAAACTCCGCTCCCTCTTCTGCGAACCAATCAAGAACTGGAAAC
 
. : . : . : . : . : . :
JMFN012J20+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF009M10+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTGTAACAAGGTGTAGAATTGGGCATGA
JMFF046G20+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTGTAACAAGGTGTAGAATTGGGCATGA
JMFF041H07+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFS045D05+ AAACCTTTCTNTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFS043C10+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF027A17+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF040A05+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF034A01+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF020D23+ CTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF025G02+ AACAAGGTGTAGAATTGGGCATGA
JMFF013J10+ CCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF014O07+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF026A08+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF038F10+ ACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF026N05+ ACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF034N08+ ACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
JMFF009F07+ TGTGCCACACATTTGTCTNTAACAAGGTGTAGAATTGGGCATGA
JMFF045K09+ AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
                      ____________________________________________________________
consensus AAACCTTTCTCTACCTTGTGCCACACATTTGTCTCTAACAAGGTGTAGAATTGGGCATGA
 
. : . : . : . : . : . :
JMFN012J20+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF009M10+ TTGAGGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF046G20+ TNGAGGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF041H07+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFS045D05+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFS043C10+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF027A17+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF040A05+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF034A01+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF020D23+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF025G02+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF013J10+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF014O07+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF026A08+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF038F10+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF026N05+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF034N08+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF009F07+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
JMFF024P11+ AATCTACGTTGAAA
JMFF045K09+ TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
                      ____________________________________________________________
consensus TTGAAGAAGGAGAGGGTGGTTTTACGGTGAAGCTCCCACAACTGGGAATCTACGTTGAAA
 
. : . : . : . : . : . :
JMFN012J20+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF009M10+ ATCCCGTCTCCTAAAATATCAAATATTTTTCGAAACTCTGGTCCTTTGGGATAGTTGGAG
JMFF046G20+ ATCCCGTCTCCTAAAATATCAAATATTTTTCGAAACTCTGGTCCTTTGGGATAGTTGGAG
JMFF041H07+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFS045D05+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFS043C10+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF027A17+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF040A05+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF034A01+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF020D23+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF025G02+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF013J10+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF014O07+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF026A08+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF038F10+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF026N05+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF034N08+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF009F07+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF024P11+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
JMFF045K09+ ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
                      ____________________________________________________________
consensus ATCCCGTCTCCCAAAATATCAAATATTTTTCGAAAATGTGGTCCTTTGGGATAGTTGGAG
 
. : . : . : . : . : . :
JMFN012J20+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF009M10+ AAGTTTTTGCTGAGGACATGGTGGATGTTAGCTGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF046G20+ AAGTTTTTGCTGAGGACATGGTGGATGTTAGCTGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF041H07+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFS045D05+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGNTGGTAGCCAGCATGCTCAAG
JMFS043C10+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF027A17+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF040A05+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF034A01+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF020D23+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF025G02+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF013J10+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF014O07+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF026A08+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF038F10+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF026N05+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF034N08+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF009F07+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF024P11+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
JMFF045K09+ AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
                      ____________________________________________________________
consensus AAGTTTTTGCTGAGGATATGGTGGATGTTAGCAGGGTCGCTGGTAGCCAGCATGCTCAAG
 
. : . : . : . : . : . :
JMFN012J20+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF009M10+ CTATCAAAGCCAGCTGGACCCTTAAACTCAAATGTCCCTCCGCTGTGTCTCAGAACATCA
JMFF046G20+ CTATCAAAGCCAGCTGGACCCTTAAACTCAAATGTCCCTCCGCTGTGTCTCAGAACATCA
JMFF041H07+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFS045D05+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFS043C10+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF027A17+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF040A05+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF034A01+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF020D23+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF025G02+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCTGCTGTGTTTCAGAACATCA
JMFF013J10+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF014O07+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF026A08+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF038F10+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF026N05+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF034N08+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF009F07+ TTAGCAAAGGCAGCTGGAACTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF024P11+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
JMFF045K09+ TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
                      ____________________________________________________________
consensus TTAGCAAAGGCAGCTGGACCTTTAAACTCAAATGTCCCTCCGCTGTGTTTCAGAACATCA
 
. : . : . : . : . : . :
JMFN012J20+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF009M10+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCCACTACT
JMFF046G20+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCCACTACT
JMFF041H07+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFS045D05+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFS043C10+ GTCGAGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF027A17+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF040A05+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF034A01+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF020D23+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF025G02+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF013J10+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF014O07+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF026A08+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF038F10+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF026N05+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF034N08+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF009F07+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF024P11+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
JMFF045K09+ GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
                      ____________________________________________________________
consensus GTCGCGAATTCGTGGACTCGGTGAGCATTCTTAAGAAGCGCCGGCATCATTCCAACTAGT
 
. : . : . : . : . : . :
JMFN012J20+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF009M10+ GCCCAGTTCGTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF046G20+ GCCCAGTTCGTAGGAACAACCTTATAATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF041H07+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFS045D05+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFS043C10+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF027A17+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF040A05+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF034A01+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF020D23+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF025G02+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF013J10+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF014O07+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF026A08+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF038F10+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF026N05+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF034N08+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF009F07+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF024P11+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
JMFF045K09+ GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
                      ____________________________________________________________
consensus GGCCAGTTCCTAGGAACAACCTTATCATCGGAGGACCGGCACCTCAATTTCAGAATCATA
 
. : . : . : . : . : . :
JMFN012J20+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAAC
JMFF009M10+ TAATAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACC
JMFF046G20+ TAATAACCCAAGCTAAGTACGATAATAAAAATGAATGCAAGCGCTGTGCTGCAGATTGCC
JMFF041H07+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFS045D05+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFS043C10+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF027A17+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGAAACC
JMFF040A05+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF034A01+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF020D23+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF025G02+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF013J10+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF014O07+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF026A08+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF038F10+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF026N05+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF034N08+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF009F07+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF024P11+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
JMFF045K09+ TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
                      ____________________________________________________________
consensus TAACAACCCAAGCTAAGTACGATAATAAAAATGAATGCAACCGCTGTGCTGCAGATTGCC
 
. : . : . : . : . : . :
JMFF046G20+ ATCATCATATCTATCT
JMFF041H07+ ATCATCATATCTATCTATCTTTCT
JMFS045D05+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAA
JMFS043C10+ ATCATCATATC
JMFF040A05+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTA
JMFF034A01+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGC
JMFF020D23+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGC
JMFF025G02+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAAT
JMFF013J10+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGC
JMFF014O07+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGC
JMFF026A08+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATG
JMFF038F10+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGCACTCC
JMFF026N05+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGCACTCC
JMFF034N08+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGCACTCC
JMFF009F07+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATACAGC
JMFF024P11+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGCACTCC
JMFF045K09+ ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGCACTCCCG
                      ____________________________________________________________
consensus ATCATCATATCTATCTATCTTTCTATCTCAGAATAATAATATTATAATGCAGCACTCCCG