Previous Contig 001942:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF045J24Sequence624001942 (3)566010563 (2)
JMSF017D05Sequence460001942 (3)756022755
JMSF021H22Sequence622001942 (3)gb:AY035039_15598170.014Arabidopsis thaliana unknown protein (At4g14990) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF021H22+ TATATCAGATAATGAACCTAATGTTGATCCCTCATCTTT
JMFF045J24+ CCTCATCTTT
                      ____________________________________________________________
consensus TATATCAGATAATGAACCTAATGTTGATCCCTCATCTTT
 
. : . : . : . : . : . :
JMSF021H22+ CTCAAACAAATGATACTCCTGTATATCTTCATCGCCAAGCCTGCCACCAACTACTCCACC
JMFF045J24+ CTCAAACAAATGATACTCCTGTATATCTTCATCGCCAAGCCTGCCACCAACTACTCCACC
                      ____________________________________________________________
consensus CTCAAACAAATGATACTCCTGTATATCTTCATCGCCAAGCCTGCCACCAACTACTCCACC
 
. : . : . : . : . : . :
JMSF021H22+ ATCAGCAGGTACACTATCTTCTTCATCTTCTAAACCACCTAACTCGACTTCCTCCAGAAC
JMFF045J24+ ATCAGCAGGTACACTATCTTCTTCATCTTCTAAACCACCTAACTCGACTTCCTCCAGAAC
                      ____________________________________________________________
consensus ATCAGCAGGTACACTATCTTCTTCATCTTCTAAACCACCTAACTCGACTTCCTCCAGAAC
 
. : . : . : . : . : . :
JMSF021H22+ ATTTCGCCCAAAAAACGCGTACTGGGATGCATCGAACATTGCACTATCAGAGACGGAGCT
JMSF017D05+ CCAAAAAACGCGTACTGGGATGCATCGAACATTGCACTATCAGAGACGGAGCT
JMFF045J24+ ATTTCGCCCAAAAAACGCGTACTGGGATGCATCGAACATTGCACTATCAGAGACGGAGCT
                      ____________________________________________________________
consensus ATTTCGCCCAAAAAACGCGTACTGGGATGCATCGAACATTGCACTATCAGAGACGGAGCT
 
. : . : . : . : . : . :
JMSF021H22+ AGAGGAGTCGGTGAAGTCTTTTAGATCCTTCTCGCCGGATCTCTCCATAATTACAACAGG
JMSF017D05+ AGAGGAGTCGGTGAAGTCTTTTAGATCCTTCTCGCCGGATCTCTCCATAATTACAACAGG
JMFF045J24+ AGAGGAGTCGGTGAAGTCTTTTAGATCCTTCTCGCCGGATCTCTCCATAATTACAACAGG
                      ____________________________________________________________
consensus AGAGGAGTCGGTGAAGTCTTTTAGATCCTTCTCGCCGGATCTCTCCATAATTACAACAGG
 
. : . : . : . : . : . :
JMSF021H22+ ACGGGAGGAAACCAGAATCTCTAGCACCAGCGGCACCTAGACATGTGTAGAACCGAAGAA
JMSF017D05+ ACGGGAGGAAACCAGAATCTCTAGCACCAGCGGCACCTAGACATGTGTAGAACCGAAGAA
JMFF045J24+ ACGGGAGGAAACCAGAATCTCTAGCACCAGCGGCACCTAGACATGTGTAGAACCGAAGAA
                      ____________________________________________________________
consensus ACGGGAGGAAACCAGAATCTCTAGCACCAGCGGCACCTAGACATGTGTAGAACCGAAGAA
 
. : . : . : . : . : . :
JMSF021H22+ AGTGAGCATTCCAGCGAATCTAAAAACTCCCTTTCGCCAGAACTGAGAACTCTAGGGTTT
JMSF017D05+ AGTGAGCATTCCAGCGAATCTAAAAACTCCCTTTCGCCAGAACTGAGAACTCTAGGGTTT
JMFF045J24+ AGTGAGCATTCCAGCGAATCTAAAAACTCCCTTTCGCCAGAACTGAGAACTCTAGGGTTT
                      ____________________________________________________________
consensus AGTGAGCATTCCAGCGAATCTAAAAACTCCCTTTCGCCAGAACTGAGAACTCTAGGGTTT
 
. : . : . : . : . : . :
JMSF021H22+ TCCAGACCAGATAAAGCGCGCGGAGAGAGAGAGAGATAGAAGGCGAGATGTAGGAACGGA
JMSF017D05+ TCCAGACCAGATAAAGCGCGCGGAGAGAGAGAGAGATAGAAGGCGAGATGTAGGAACGGA
JMFF045J24+ TCCAGACCAGATAAAGCGCGCGGAGAGAGAGAGAGATAGAAGGCGAGATGTAGGAACGGA
                      ____________________________________________________________
consensus TCCAGACCAGATAAAGCGCGCGGAGAGAGAGAGAGATAGAAGGCGAGATGTAGGAACGGA
 
. : . : . : . : . : . :
JMSF021H22+ AAAACGCGCGGTTTTTGGTGCGGAGAGCGTGAATCTATATGAGGAGGATGAAGATGAAGA
JMSF017D05+ AAAACGCGCGG-TTTTGGTGCGGAGAGCGTGAATCTATATGAGGAGGATGAAGATGAAGA
JMFF045J24+ AAAACGCGCGGTTTTTGGTGCGGAGAGCGTGAATCTATATGAGGAGGATGAAGATGAAGA
                      ____________________________________________________________
consensus AAAACGCGCGGTTTTTGGTGCGGAGAGCGTGAATCTATATGAGGAGGATGAAGATGAAGA
 
. : . : . : . : . : . :
JMSF021H22+ AGAGGGTGTGATGAGGTTTTTGTGTTTCCGCGAAAGTGAGAGCGGGGAAGGGAAAGTTCG
JMSF017D05+ AGAGGGTGTGATGAGGTTTTTGTGTTTCCGCGAAAGTGAGAGCGGGGAAGGGAAAGTTCG
JMFF045J24+ AGAGGGTGTGATGAGGTTTTTGTGTTTCCGCGAAAGTGAGAGCGGGGAAGGGAAAGTTCG
                      ____________________________________________________________
consensus AGAGGGTGTGATGAGGTTTTTGTGTTTCCGCGAAAGTGAGAGCGGGGAAGGGAAAGTTCG
 
. : . : . : . : . : . :
JMSF021H22+ AGCCGCGGGGGTGAGCGGAGCTTCGGCCTTCGTCAACTCACC
JMSF017D05+ AGCCGCGGGGGTGAGCGGAGCTTCGGCCTTCGTCAACTCACC
JMFF045J24+ AGCCGCGGGGGTGAGCGGAGCTTCGGCCTTCGTCAACTCACCAATTCGGCTAATGACTAC
                      ____________________________________________________________
consensus AGCCGCGGGGGTGAGCGGAGCTTCGGCCTTCGTCAACTCACCAATTCGGCTAATGACTAC