Previous Contig 001936:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF021F13Sequence390001936 (2)sp|P93263|METE_MESCR5e-35 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1445009104 (8)gb:AF082893_17667033e-51Solanum tuberosum methionine synthase (MS) mRNA, complete cds.
JMFF045H06Sequence669001936 (2)gb:AF439723_17999814e-75Zea mays methionine synthase mRNA, partial cds.282009104 (8)sp|Q42699|METE_CATRO6e-04 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF045H06+ TGGCAGGTT
                      ____________________________________________________________
consensus TGGCAGGTT
 
. : . : . : . : . : . :
JMFF045H06+ GGATAGCAACAAGTATGATACTGGACCAACAAGAACTGGGACAGTTCNAACACCAAGCGC
                      ____________________________________________________________
consensus GGATAGCAACAAGTATGATACTGGACCAACAAGAACTGGGACAGTTCNAACACCAAGCGC
 
. : . : . : . : . : . :
JMFF045H06+ NTTAGCCTCCTTGTATTCGGTCACTGCTTTGTGGGAAGCATAAGAGAATTTGACATCAGG
                      ____________________________________________________________
consensus NTTAGCCTCCTTGTATTCGGTCACTGCTTTGTGGGAAGCATAAGAGAATTTGACATCAGG
 
. : . : . : . : . : . :
JMFF045H06+ ACCCAACTCAGGGACAATGAAGTGGTAGTTGGTATCGAACCACTTGGTCATTTCCATGGC
                      ____________________________________________________________
consensus ACCCAACTCAGGGACAATGAAGTGGTAGTTGGTATCGAACCACTTGGTCATTTCCATGGC
 
. : . : . : . : . : . :
JMFF045H06+ AGGGACAGAGGCATTTCCTCTGGCCATGGAGAAGTAAGTATCAAATCCAATCTCACCGCC
                      ____________________________________________________________
consensus AGGGACAGAGGCATTTCCTCTGGCCATGGAGAAGTAAGTATCAAATCCAATCTCACCGCC
 
. : . : . : . : . : . :
JMFF021F13+ CACCGAGCATGGCAGTGGTGTCGAGCACGTGATC
JMFF045H06+ AGCCCAGTTGTACCTTGGGGGTACAGCACCGAGCATGGCAGTGGTGTCGAGCACGTGATC
                      ____________________________________________________________
consensus AGCCCAGTTGTACCTTGGGGGTACAGCACCGAGCATGGCAGTGGTGTCGAGCACGTGATC
 
. : . : . : . : . : . :
JMFF021F13+ ATAGTAAGAGAAAGTGTTGNTGGGAATGAACTTGATCCCAGCATCAGCCATCTGTTTCCA
JMFF045H06+ ATAGTAAGAGAAAGTGTTGCTGGGAATGAACTTGATCCCAGCATCAGCCATCTGTTTCCA
                      ____________________________________________________________
consensus ATAGTAAGAGAAAGTGTTGCTGGGAATGAACTTGATCCCAGCATCAGCCATCTGTTTCCA
 
. : . : . : . : . : . :
JMFF021F13+ TATGGATGCCCTGAGGTCAGCTGACACCTTCTGCAGATCCTCAGCACTGCTCTTCCCATC
JMFF045H06+ TATGGATGCCCTGAGGTCAGCTGACACCTTCTGCAGATCCTCAGCACTGCTCTTCCCATC
                      ____________________________________________________________
consensus TATGGATGCCCTGAGGTCAGCTGACACCTTCTGCAGATCCTCAGCACTGCTCTTCCCATC
 
. : . : . : . : . : . :
JMFF021F13+ CCAAAAAGACTCAAGAGCAAATTTGAGCTCTCTCTTCGGGCCCATGCGGGGATATCCAAC
JMFF045H06+ CCAAAAAGACTCAAGAGCAAATTTGAGCTCTCTCTTCGGGCCCATACGGGGATATCCAAC
                      ____________________________________________________________
consensus CCAAAAAGACTCAAGAGCAAATTTGAGCTCTCTCTTCGGGCCCATGCGGGGATATCCAAC
 
. : . : . : . : . : . :
JMFF021F13+ AATGTGAGATGCCATTTTTTCTGTTCTACGTATAGATTAGCTTATTAGCTTAAATTAGAT
JMFF045H06+ AATGTGAGATGCCATTTTTTCTGTTCTACGTATAGATTAGCTTATTAGCTTAAATTAGAT
                      ____________________________________________________________
consensus AATGTGAGATGCCATTTTTTCTGTTCTACGTATAGATTAGCTTATTAGCTTAAATTAGAT
 
. : . : . : . : . : . :
JMFF021F13+ GAAGAACAAGCGTAAATGAGTGAGAGAAAACGAAAAGCTAGTACTAATCTGCAGTTTTTA
JMFF045H06+ GAAGAACAAGCGTAAATGAGTGAGAGAAAACGAAAAGCTAGTACTAATCTGCAGTTTTTA
                      ____________________________________________________________
consensus GAAGAACAAGCGTAAATGAGTGAGAGAAAACGAAAAGCTAGTACTAATCTGCAGTTTTTA
 
. : . : . : . : . : . :
JMFF021F13+ TGAGCTATATAAAGAAGCTAGTGGTGACGAATGCTAGAAATATTTCATCATGATTC
JMFF045H06+ TGAGCTATATAAAGAAGCTAGTGGTGACGAATGCTAGAAATATTTCATCATGATTCCGGT
                      ____________________________________________________________
consensus TGAGCTATATAAAGAAGCTAGTGGTGACGAATGCTAGAAATATTTCATCATGATTCCGGT